Effects of Carbon Source on Growth Characteristics and Lipid Accumulation by Microalga <i>Dictyosphaerium</i> sp. with Potential for Biodiesel Production

Abstract

Sustainability and eco-friendliness have both engendered research on alternative replacement of fossil fuel. This study was aimed at determining the effects of varying levels of glucose (10 ~ 40 g/L), and glycerol (0.25 ~ 1.0 mL/L) on the heterotrophic and mixotrophic growth and lipid production by Dictyosphaerium sp. The microalga was cultivated in 2000 mL amber-coloured bottles each containing 1000 mL of a sterile modified BG-11 medium at pH of 7.3. Each bottle was inoculated with a one-week-old pure culture of the isolate (inoculum ratio = 15%) and incubated in the dark at room temperature (30˚C ± 2˚C) for 10 d. Dictyosphaerium sp. showed the ability to grow heterotrophically and mixotrophically on glucose and on glycerol as a sole carbon substrates. Biomass productivity and specific growth rates did not vary when the initial medium glucose was varied. Lipid accumulation was not dependent on the initial medium glycerol contents. The mean lipid content and productivity of the organism in the present study were high enough to be utilised for industrial processes. Growth and lipid accumulations were better in mixotrophic cultures than both heterotrophic and autotrophic. However, both were better than autotrophic. The percentage compositions of the major fatty acids from Dictyosphaerium sp. grown under different culture conditions show at least five components each. The carbon skeletons eluted ranged from C14 to C22. Oleic acid was a major component of all the fatty acids, which confirm the suitability of the use of the oil for biodiesel production.

Pemanfaatan Mikroalga Chlorella Sp Untuk Produksi Lipid Dalam Media Limbah Cair Hotel Dengan Variasi Rasio C:n Dan Panjang Gelombang Cahaya

“…Untuk menentukan berat kering, mikroalga disentrifus pada 5000 rpm selama 5 menit, kemudian dicuci dengan aquades sebanyak 2 kali dan dikeringkan pada suhu 105ºC hingga mencapai berat konstan (Leesing dkk, 2014;Cho dkk, 2011). Nilai berat kering dapat dihitung menggunakan rumus (Ogbonna, 2018):…”

Potential of <i>Dictyosphaerium</i> sp. LC172264 Concomitant Remediation of Cassava Wastewater and Accumulation of Lipids for Biodiesel Production

“…The highest lipid content (%) for autotrophic, heterotrophic and mixotrophic culture modes were 15.32, 16.54 and 21.16 respectively whereas the biomass contents were 0.238, 0.63 and 1.022 g/L respectively. Using CWW as carbon and additional nitrogen source gave lower percentage lipid content than what was previously reported (42.3% ± 1.33%) where glucose and glycerol were the carbon sources [14]. The reason for the disparity could be the differences in medium compositions since glucose as a carbon source is more easily assimilated than hydrolyzed cassava starch.…”

“…Evidence supporting superiority of mixotrophic cultivation of some microalgae in organic carbon substrates had been recorded [27] [28]. In a previous study with the microalga, Ogbonna and Ogbonna [14] had demonstrated the heterotrophic and mixotrophic growth ability of the isolate using glucose and glycerol as substrates. However, using glucose and glycerol as substrates, higher biomass content was recorded than the biomass of the present study.…”

“…Dictyosphaerium sp. used for this study was previously isolated and identified with 18S rRNA sequencing using 18S forward-(ITS-1)'TTTCTGCCCTATCAACTTTCGATG' and 18S reverse-(ITS-4)'TACAAAGGGCAGGGACGTAAT' primers [14] [17] [18]. The organism was deposited in the GenBank under an Accession Code LC172264.…”

“…Dictyosphaerium sp. has been shown to be a high lipid producer and its applicability in biodiesel production has also been demonstrated [14]. Jiang et al [15] used a high-lipid producing Dictyosphaerium ehrenbergianum grown in struvite precipitated liquid digestate for biodiesel production, with lipid and biomass productivities being higher than when cultured in the standard BG-11 medium.…”