Effects of 5′ Regulatory-Region Polymorphisms on Paraoxonase-Gene (PON1) Expression

Abstract

Human HDL-associated paraoxonase (PON1) hydrolyzes a number of toxic organophosphorous compounds and reduces oxidation of LDLs and HDLs. These properties of PON1 account for its ability to protect against pesticide poisonings and atherosclerosis. PON1 also hydrolyzes a number of lactone and cyclic-carbonate drugs. Among individuals in a population, PON1 levels vary widely. We previously identified three polymorphisms in the PON1 regulatory region that affect expression levels in cultured human hepatocytes. In this study, we determined the genotypes of three regulatory-region polymorphisms for 376 white individuals and examined their effect on plasma-PON1 levels, determined by rates of phenylacetate hydrolysis. The -108 polymorphism had a significant effect on PON1-activity level, whereas the -162 polymorphism had a lesser effect. The -909 polymorphism, which is in linkage disequilibrium with the other sites, appears to have little or no independent effect on PON1-activity level in vivo. Other studies have found that the L55M polymorphism in the PON1-coding region is associated with differences in both PON1-mRNA and PON1-activity levels. The results presented here indicate that the L55M effect of lowered activity is not due to the amino acid change but is, rather, largely due to linkage disequilibrium with the -108 regulatory-region polymorphism. The codon 55 polymorphism marginally appeared to account for 15.3% of the variance in PON1 activity, but this dropped to 5% after adjustments for the effects of the -108 and Q192R polymorphisms were made. The -108C/T polymorphism accounted for 22.8% of the observed variability in PON1-expression levels, which was much greater than that attributable to the other PON1 polymorphisms. We also identified four sequence differences in the 3' UTR of the PON1 mRNA.

Paraoxonase gene variants are associated with autism in North America, but not in Italy: possible regional specificity in gene–environment interactions

“…This conclusion is in accordance with prior findings, showing a relatively homogeneous genetic structure within Caucasian ethnic groups at this locus, in the face of large inter-racial differences between Caucasians, African-Americans, Chinese, Japanese, Asian-Indians, and Hispanics. 42 It also fits with our Italian controls displaying genotypic and allelic distributions very similar to those of the large sample of CaucasianAmerican controls reported by Brophy et al, 27 and employed here as ethnically matched controls for our Caucasian-American patients (Table 2). Therefore, this genetic association, unless due to chance, must be explained at some pathophysiological level.…”

“…Caucasian-American, but not Italian, patients also display a nonsignificant trend toward increased allele frequencies and transmission rates of the TÀ108 allele, which is associated with approximately 50% decrease in paraoxonase serum levels (Tables 2 and 3). 27,41 The consistency of our case-control and intrafamilial association analyses, the preferential transmission of R192 alleles to Caucasian-American patients and not to their unaffected siblings, the homogenous genetic structure of Italians and CaucasianAmericans at the PON1 locus, and the constellation of biochemical and morphological features, which surprisingly characterizes R192 allele carriers, all strongly support the reliability and biological significance of these findings.…”

“…26,27 Briefly, (a) the CÀ108T SNP was amplified using primers GACC GCAAGCCACGCCTTCTGTGCACC and TGCAGCCG CAGCCCTGCTGGGGCAGCGCCGATTGGCCCGCCGC with 5% DMSO and an annealing temperature of 631C for 35 cycles. The 109 bp fragment was digested with BstUI, yielding 67 and 42 bp fragments in the presence of the C allele.…”

“…26,27 Paraoxonase is the serum enzyme physiologically involved in protecting low-density lipoproteins (LDL) and high-density lipoproteins (HDL) from oxidation, and is responsible for OP inactivation in humans. 28,29 The three SNPs assessed here are the best-characterized functional polymorphisms affecting either the amount of serum paraoxonase or its affinity for specific substrates, ultimately leading to impressive interindividual differences in human serum paraoxonase activity.…”

“…28,29 The three SNPs assessed here are the best-characterized functional polymorphisms affecting either the amount of serum paraoxonase or its affinity for specific substrates, ultimately leading to impressive interindividual differences in human serum paraoxonase activity. [26][27][28][29] In particular, TÀ108 is associated with approximately 50% reduction in paraoxonase serum levels compared to CÀ108; 27 L/M55 alleles only marginally affect PON1 gene expression, but are in tight linkage disequilibrium (LD) with C/TÀ108 and Q/R192 alleles, respectively; 26,28,29 Q192 displays reduced affinity for chlorpyrifos, while R192 is significantly less active on diazinon in vitro. [26][27][28][29] This hypothesisdriven study therefore tests whether (a) CaucasianAmerican, and not Italian, families show a significant association between PON1 alleles and autism; (b) PON1 alleles associated with autism are those conferring reduced protection against OP exposure, by yielding either lower amounts of serum paraoxonase (TÀ108/M55) or possibly decreased affinity for diazinon (R192) or chlorphyrifos (Q192); and (c) there is evidence for potential gene-gene interactions between PON1 and RELN gene variants in autism pathogenesis.…”