Effective targeting of intact and proteolysed CDCP1 for imaging and treatment of pancreatic ductal adenocarcinoma

Kryza, Thomas; Khan, Tashbib; Puttick, Simon; Li, Chao; Sokolowski, Kamil A.; Tse, Brian Wan-Chi; Cuda, Tahleesa; Lyons, Nicholas; Gough, Madeline; Yin, Julia; Parkin, Ashleigh; Deryugina, Elena I.; Quigley, James P.; Law, Ruby H. P.; Whisstock, James C.; Riddell, Andrew D.; Barbour, Andrew P.; Wyld, David; Thomas, Paul; Rose, Stephen; Snell, Cameron; He, Yaowu; Hooper, John D.

doi:10.7150/thno.43589

Cited by 24 publications

(48 citation statements)

References 53 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The present work also contributes significantly to delineating the importance of the CDCP1 cleavage axis in progression of a growing list of malignancies including ovarian 34,54,55 , breast 47 , prostate 35 , colorectal 43 and pancreatic 42,45 cancer. Our results support previous studies indicating the role of uPA 40 and plasmin 35,56 in CDCP1 proteolysis and extend these results by establishing this proteolytic axis in CDCP1-mediated cancer progression using diseaserelevant models and patient samples.…”

Section: Discussionmentioning

confidence: 86%

“…Ovarian cancer CaOV3 and OVMZ6, and prostate cancer PC3 cell lines were from ATCC (Manassas, VA) and cultured according to supplier protocols. Patient derived pancreatic ductal adenocarcinoma cells TKCC05 and TKCC10 were cultured as described previously 42,47,60 . To avoid artificial cleavage of CDCP1, cell passages were performed non-enzymatically with Versene (0.48 mM EDTA in PBS, pH 7.4).…”

Section: Cell Lines and Patient-derived Cellsmentioning

confidence: 99%

“…Using a previously described protocol 42,44 , cells were stably transduced using lentiviral particle containing pLKO.1 vector (Horizon Discovery, Waterbeach, UK) encoding: CDCP1-specific shRNA (shCDCP1 44 ), one of two uPA-specific shRNA (shuPA#1 or #2, targeting sequences: CGCATGACTTTGACTGGAATT and CCCAAAGAAGGAGGACTACAT, respectively), one of two uPA receptor-specific shRNA (shuPAR#1 or #2, targeting sequences: GCTTGAAGATCACCAGCCTTA and CCTGAAGAACAGTGCCTGGAT, respectively) or a Non-targeting shRNA (shNT 44 ). In addition, TKCC05 cells stably expressing shCDCP1 were generated from cells pre-labelled with a previously described luciferase-coding construct to generate TKCC05-Luciferase-shCDCP1 42,44 . TKCC05-Luciferase-shCDCP1 and OVMZ6 cells were transduced with a pLenti-PGK-Hygro-DEST expression construct (w530-1, Addgene, Cambridge, MA) inserted with coding sequence of wild type CDCP1 (WT-CDCP1) or a cleavage sites mutated form of CDCP1 (R 368 A and K 369 A; designated DM) [40][41].…”

Section: Cell Lines and Patient-derived Cellsmentioning

confidence: 99%

“…CUB Domain-Containing Protein 1 (CDCP1) is a single pass transmembrane receptor 34 which promotes oncogenic signaling in cooperation with receptors [34][35][36][37][38] including EGFR, HER2 and β1 integrin. Extracellular CDCP1 proteolysis which is essential for pro-metastatic signaling converts full-length (FL) 135 kDa CDCP1 to a 70 kDa transmembrane carboxyl-terminal fragment (CTF) and a 65 kDa amino-terminal fragment (ATF) that is either shed from the cell surface [39][40][41] or remains tethered to CDCP1-FL/-CTF 42 , potentially allowing paracrine, autocrine and/or juxtracrine signaling (Fig. 1a).…”

Section: Introductionmentioning

confidence: 99%

“…1a). Elevated CDCP1 expression is associated with poor prognosis in diverse human cancers 36,37,[42][43][44][45][46] . In preclinical models CDCP1 proteolysis promotes vascular metastasis of prostate cancer 35 and CDCP1 homodimerization-induced cell migration in triple-negative breast cancer 47 .…”

Section: Introductionmentioning

confidence: 99%

See 4 more Smart Citations

Substrate-biased activity-based probes identify the urokinase-plasminogen axis as a master regulator of metastatic signaling by orphan membrane receptor CDCP1

Kryza¹,

Khan²,

Lovell³

et al. 2020

Preprint

Self Cite

View full text Add to dashboard Cite

CDCP1 is an oncogenic orphan transmembrane receptor and a promising target for detection and treatment of cancer. Extracellular proteolysis of CDCP1 by poorly defined mechanisms induces pro-metastatic signaling. We describe a novel approach for rapid identification of proteases responsible for key proteolytic events exploiting a substrate-biased activity-based probe (sbABP) that incorporates a substrate cleavage motif grafted onto a peptidyl-diphenyl-phosphonate warhead for specific target protease capture, isolation and identification. Using a CDCP1-biased probe we identify urokinase (uPA) as the master regulator of CDCP1 proteolysis, both by direct cleavage and via activation of CDCP1-cleaving plasmin. We show that co-expression of uPA and CDCP1 is strongly predictive of poor disease outcome across multiple cancers and demonstrate that uPA-mediated CDCP1 proteolysis promotes metastasis in disease-relevant preclinical in vivo models. These results highlight CDCP1 cleavage as a potential target to disrupt cancer and establish sbABP technology as a new approach to identify disease-relevant proteases.

show abstract

Section: Discussionmentioning

confidence: 86%

Section: Cell Lines and Patient-derived Cellsmentioning

confidence: 99%

Section: Cell Lines and Patient-derived Cellsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

Substrate-biased activity-based probes identify the urokinase-plasminogen axis as a master regulator of metastatic signaling by orphan membrane receptor CDCP1

Kryza¹,

Khan²,

Lovell³

et al. 2020

Preprint

Self Cite

View full text Add to dashboard Cite

show abstract

Molecular imaging of pancreatic ductal adenocarcinoma

Huang

et al. 2023

VIEW

View full text Add to dashboard Cite

Pancreatic ductal adenocarcinoma (PDAC), a deadly cancer characterized by multiple molecular alterations, remains the most lethal cancer, with a 5‐year survival rate of about 3–15%. Early diagnosis and treatment monitoring are essential to improve patient survival. Traditional imaging methods can only provide structural information, but not biological processes. Nuclear medicine imaging combines the high sensitivity of radionuclides with high‐resolution structural imaging to visualize specific targets of PDAC for more accurate and reliable diagnosis and monitoring of therapeutic responses. In this review, we summarize the available literature regarding molecular nuclear medicine imaging in PDAC. We classify the probe targets into two categories, targeting tumor cell membranous and the tumor microenvironment, respectively. We summarize the latest evidence in this field and outline how these emerging strategies could potentially optimize clinical practice.

show abstract

Mechanistic insights into CDCP1 clustering on non-small-cell lung cancer membranes revealed by super-resolution fluorescent imaging

Qi¹,

Li²,

Zhang³

et al. 2023

iScience

View full text Add to dashboard Cite

Effective targeting of intact and proteolysed CDCP1 for imaging and treatment of pancreatic ductal adenocarcinoma

Cited by 24 publications

References 53 publications

Substrate-biased activity-based probes identify the urokinase-plasminogen axis as a master regulator of metastatic signaling by orphan membrane receptor CDCP1

Substrate-biased activity-based probes identify the urokinase-plasminogen axis as a master regulator of metastatic signaling by orphan membrane receptor CDCP1

Molecular imaging of pancreatic ductal adenocarcinoma

Mechanistic insights into CDCP1 clustering on non-small-cell lung cancer membranes revealed by super-resolution fluorescent imaging

Contact Info

Product

Resources

About