Effect of Sex Differences on Brain Mitochondrial Function and Its Suppression by Ovariectomy and in Aged Mice

Abstract

Sex steroids regulate brain function in both normal and pathological states. Mitochondria are an essential target of steroids, as demonstrated by the experimental administration of 17β-estradiol or progesterone (PROG) to ovariectomized female rodents, but the influence of endogenous sex steroids remains understudied. To address this issue, mitochondrial oxidative stress, the oxidative phosphorylation system, and brain steroid levels were analyzed under 3 different experimental sets of endocrine conditions. The first set was designed to study steroid-mediated sex differences in young male and female mice, intact and after gonadectomy. The second set concerned young female mice at 3 time points of the estrous cycle in order to analyze the influence of transient variations in steroid levels. The third set involved the evaluation of the effects of a permanent decrease in gonadal steroids in aged male and female mice. Our results show that young adult females have lower oxidative stress and a higher reduced nicotinamide adenine dinucleotide (NADH)-linked respiration rate, which is related to a higher pyruvate dehydrogenase complex activity as compared with young adult males. This sex difference did not depend on phases of the estrous cycle, was suppressed by ovariectomy but not by orchidectomy, and no longer existed in aged mice. Concomitant analysis of brain steroids showed that pregnenolone and PROG brain levels were higher in females during the reproductive period than in males and decreased with aging in females. These findings suggest that the major male/female differences in brain pregnenolone and PROG levels may contribute to the sex differences observed in brain mitochondrial function.

Bovine and murine models highlight novel roles for SLC25A46 in mitochondrial dynamics and metabolism, with implications for human and animal health

“…Total DNA was extracted from brain, liver and muscle homogenates using a standard procedure [74]. The mtDNA copy number per cell was measured by quantitative PCR based on the ratio of mtDNA ( MTCO2 gene) to nDNA ( PPIB gene), as described [74].…”

“…The mtDNA copy number per cell was measured by quantitative PCR based on the ratio of mtDNA ( MTCO2 gene) to nDNA ( PPIB gene), as described [74]. Long-range PCR was performed to detect large mtDNA deletions with primers F1 ACGGGACTCAGCAGTGATAAAT;R1 GCTCCTTCTTCTTGATGTCTT (expected size, 15144 bp).…”

Social Origins of Developmental Risk for Mental and Physical Illness

“…To address this, an alternative limited-bedding paradigm was initially developed in rats (Gilles et al, 1996), obviating the requirement for overt separation of pups and dams typically used in rodent ELS models . This paradigm induces inconsistent and fragmented maternal care (Heun-Johnson and Levitt, 2016), which has since been validated and adopted for use with mice by multiple laboratories Wang et al, 2011Wang et al, , 2013Gunn et al, 2013;Malter Cohen et al, 2013;Liao et al, 2014;Kohl et al, 2015;Naninck et al, 2015;Yang et al, 2015;Arp et al, 2016;Bath et al, 2016Bath et al, , 2017Liu et al, 2016;McIlwrick et al, 2016McIlwrick et al, , 2017Yam et al, 2017).…”

“…Sex differences in mitochondrial function have been reported and are typically associated with levels of circulating gonadal hormones following puberty (Gaignard et al, 2015) and the decline in estrogen and progesterone following menopause (Irwin et al, 2012;Rettberg et al, 2014;Yin et al, 2015).…”

Progesterone reduces brain mitochondrial dysfunction after transient focal ischemia in male and female mice

“…6 The rate of oxygen consumption was calculated from the slope of the response of mitochondria to the successive administration of substrates and expressed as nmol O 2 /min/mg protein.…”