Effect of Photocaged Isopropyl β‐d‐1‐thiogalactopyranoside Solubility on the Light Responsiveness of LacI‐controlled Expression Systems in Different Bacteria

Abstract

Photolabile protecting groups play a significant role in controlling biological functions and cellular processes in living cells and tissues, as light offers high spatiotemporal control, is non‐invasive as well as easily tuneable. In the recent past, photo‐responsive inducer molecules such as 6‐nitropiperonyl‐caged IPTG (NP‐cIPTG) have been used as optochemical tools for Lac repressor‐controlled microbial expression systems. To further expand the applicability of the versatile optochemical on‐switch, we have investigated whether the modulation of cIPTG water solubility can improve the light responsiveness of appropriate expression systems in bacteria. To this end, we developed two new cIPTG derivatives with different hydrophobicity and demonstrated both an easy applicability for the light‐mediated control of gene expression and a simple transferability of this optochemical toolbox to the biotechnologically relevant bacteria Pseudomonas putida and Bacillus subtilis. Notably, the more water‐soluble cIPTG derivative proved to be particularly suitable for light‐mediated gene expression in these alternative expression hosts.

Optochemical Control of Bacterial Gene Expression: Novel Photocaged Compounds for Different Promoter Systems

“…Previously published photocaged carbohydrates showed absorption maxima in the range of 336-358 nm. [14][15]17] In contrast, the absorption maxima (λ max ) of compounds 1 b + d and 2 b-c are redshifted by at least 28-50 nm and show peak at ~386 nm (Figure 3A). An exception is the photocaged IPTG 1 c, which showed an additional strong bathochromic shift of ~100 nm to an absorption maximum at 488 nm, due to the introduction of the dicyanomethylene group (Figures S1-6).…”

“…Among them, only photocaged IPTG derivatives were recently applied to alternative production hosts, namely Corynebacterium glutamicum, [16] Pseudomonas putida, [17] and Bacillus subtilis. [17] A photocaged compound has to fulfil different requirements: It should offer strong absorption (ɛ) at the desired wavelength, a high quantum yield (�) and efficiency (ɛ�) of the corresponding photoreaction, as well as a low background activity prior to irradiation. Furthermore, it must be non-toxic and stable as well as soluble in the targeted media.…”

“…Escherichia coli . Among them, only photocaged IPTG derivatives were recently applied to alternative production hosts, namely Corynebacterium glutamicum , [16] Pseudomonas putida , [17] and Bacillus subtilis . [17] …”

The iSplit GFP assay detects intracellular recombinant proteins in Bacillus subtilis

“…For construction of the B. subtilis expression vector pHT01-GFP1-10, the already existing vector pET22b-GFP1-10 [ 18 ] was used as a template for SLIC cloning [ 38 ] of a DNA fragment encoding GFP1-10 into the vector pHT01 using the primer pair 1f-i-pET22b-s-o(Vec) (5′ GGATAACAATTCCCAATTAAAGGAGGAGATATACATATGAGCAAAGGAGAAGA 3′)/1r-i-pET22b-s-o(Vec) (5′ GTATCCTCTAAGTAATATGAATTCCCTTCCAGCCGGATCTCAGTGGT 3′) for amplification of GFP1-10 gene and the primer pair Vf-pHT01 (5′ GAAGGGAATTCATATTACTTAGAGGATACT 3′)/Vr-pHT01 (5′ CCTCCTTTAATTGGGAATTGTTATCCG 3′) for amplification of the pHT01 vector. For obtaining pHT01-iSplitGFP, a stop codon was introduced into the pHT01-sfGFP vector [ 39 ] by exchanging CGT with TGA at base pair positions 643–645 via QuikChange® PCR [ 40 ] with the primer pair QC-fw-GFPR215STOP(5′ GATCCCAACGAAAAGTGAGACCACATGGTCCTTC 3′)/ QC-rev-GFPR215STOP (5′ GAAGGACCATGTGGTCTCACTTTTCGTTGGGATC 3′).…”

Precise and reliable control of gene expression in Agrobacterium tumefaciens

“…They are also employed for practical purposes such as the production of fuels, chemicals, and pharmaceuticals. Recently, efforts have been devoted to engineer nonmodel organisms, such as Klebsiella oxytoca (Temme et al, 2012), Comamonas testosterone (Tang et al, 2018), and Streptomyces venezuelae (Moore et al, 2021), and to establish sensor and control circuits (Hogenkamp et al, 2021; Martin‐Pascual et al, 2021) to increase the programmability of nonmodel species. These advances encouraged us to develop synthetic biology tools for efficient control of gene expression in agrobacterium as a way to advance plant biotechnology and to increase the understanding of agrobacterium genetics and physiology.…”