Effect of ionizing radiation on the bacterial and fungal endophytes of the halophytic plant Kalidium schrenkianum

Abstract

Endophytes are microbes found within tissues of plants in various types of terrestrial and aquatic ecosystems, including those habitats with ionizing radiation. Our study investigates the differences in composition of bacterial and fungal endophytes associated with the halophytic plant Kalidium schrenkianum and the effects of geochemical factors and radiation (at low, medium, high level and control) on the community structure of endophytic bacteria and fungi. The bacterial class Actinobacteria and the fungal class Dothideomycetes predominated the endophytic communities of K. schrenkianum. Aboveground parts had higher fungal diversity while belowground parts had higher bacterial diversity. Soil pH, total nitrogen, and organic matter showed significant effects on the diversity of root endophytes. Radiation had no significant effect on the abundance of different bacterial classes. Sordariomycetes predominated the root fungal microbiota under high radiation intensity. Differences in the endophytic communities between aboveground and belowground parts were more than that between the radiation levels. No significant differences were found in the aboveground bacterial communities among the radiation levels. Radiation showed a significant effect on the fungal co-occurrence networks. Negative correlations were found between endophytic bacteria and fungi in the plant. The genetic diversity of both endophytic bacteria and fungi was higher in radioactive environments. Our findings suggest that the endophytes associated with aboveground and belowground parts of K. schrenkianum follow different mechanisms for community assembly and different paradigms in stress response.

Dendrobium officinale Endophytes May Colonize the Intestinal Tract and Regulate Gut Microbiota in Mice

“…Primers 799 F (5′-AACMGGATTAGATACCCKG-3′) and 1193R (5′-ACGTCATCCCCACCTTCC-3′) outperform all other primer pairs in our study in the elimination of nontarget DNA and retrieval of bacterial OTUs [24]. In the plant and fecal samples, fungal internal transcribed spacer region 1 (ITS1 region) of ribosomal RNA was amplified using ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) primers [12].…”

“…Microbes that colonize inner plant tissues are designated endophytes. Endophytes exist widely in host plants and are important components of plant microecosystems [12]. Endophytes have increasingly become the research hotspot of scholars worldwide because they can produce active components, promote host plant growth, and enhance the host plant resistance against biotic and abiotic stresses [13,14].…”