Effect of feeding lambs with a tanniferous shrub (rockrose) and a vegetable oil blend on fatty acid composition of meat lipids

Francisco, Alexandra; Alves, Susana P.; Portugal, P.V.; Pires, Virgínia M. R.; Dentinho, M. T.; Alfaia, Cristina M.; Jerónimo, Eliana; Prates, José A. M.; Santos‐Silva, José; Bessa, Rui J.B.

doi:10.1017/s1751731116001129

Cited by 23 publications

(12 citation statements)

References 33 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…First-strand cDNA was synthesized from 0.5 µg total RNA using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems Inc., Foster City, CA) according to the manufacturer's instructions. Real-time PCR was performed as previously described (Francisco et al, 2016) using a StepOnePlus Real-Time PCR System (Applied Biosystems Inc.). Primer sequences used for amplification of SCD and acetyl-CoA carboxylase (ACACA) genes were previously reported by Francisco et al (2016) and Madeira et al (2013).…”

Section: Gene Expressionmentioning

confidence: 99%

“…Real-time PCR was performed as previously described (Francisco et al, 2016) using a StepOnePlus Real-Time PCR System (Applied Biosystems Inc.). Primer sequences used for amplification of SCD and acetyl-CoA carboxylase (ACACA) genes were previously reported by Francisco et al (2016) and Madeira et al (2013). Gene-specific intron-spanning primers for fatty acid synthase (FASN) were designed as described by Francisco et al (2016) and Madeira et al (2013) and their sequences (from 5′ end to 3′ end) were CCAAGTACAATGGCACCCTGA and TCTCCTCGGTGAGCTGCG for forward and reverse primer, respectively.…”

Section: Gene Expressionmentioning

confidence: 99%

See 1 more Smart Citation

The reduction of starch in finishing diets supplemented with oil does not prevent the accumulation of trans-10 18:1 in lamb meat1

Costa

Alves

Francisco

et al. 2017

Journal of Animal Science

Self Cite

View full text Add to dashboard Cite

The experiment was conducted to test the hypothesis that the replacement of cereal with low-starch feed ingredients in lambs' finishing diets supplemented with oils could prevent the accumulation of -10-18:1 in meat. Forty lambs were fed 1 of 4 diets supplemented with soybean oil (5.9%) and fish oil (1%) for 6 wk before slaughter. The control (CON) diet contained 43% barley, and in the other diets, barley was completely replaced by dehydrated citrus pulp (DCP), dehydrated sugar beet pulp (DBP), or soybean hulls (SH). Growth performance, feed intake, and carcass and meat quality traits were analyzed. At slaughter, LM samples were collected for gene expression evaluation, and 3 d after slaughter, LM and subcutaneous (s.c.) fat samples were collected for fatty acid analysis. None of the diets affected meat quality, but the DCP diet reduced ADG ( < 0.05) and the DCP and SH diets decreased the feed-to-gain ratio ( < 0.01). The DCP diet increased ( < 0.05) the risk of parakeratosis and the severity of the lesions. Moreover, the DBP treatment led to increased a* (redness) and b* (yellowness) in s.c. fat compared with the CON treatment ( < 0.05). The lipid content of LM did not differ ( > 0.05) with treatment and averaged 34.4 g/kg of meat. Diets had no effect ( > 0.05) on SFA, PUFA, and -MUFA sums and on the -6:-3 ratio in both LM and s.c. fat. A lower expression of fatty acid synthase (FASN) was found with the DCP treatment than with the other treatments ( < 0.001). All treatments showed a high accumulation of -10-18:1, averaging 91 mg/g fatty acid in LM and 147 mg/g fatty acid in s.c. fat. The concentration of -11-18:1 in the tissues was considerably lower than that of -10-18:1, and thus the -10-18:1:-11-18:1 ratio was above 3 with all treatments. Despite this, the SH diet clearly promoted a larger deposition of -11-18:1 and -9,-11-18:2 in tissues compared with the other treatments. () gene expression and SCD activity index in LM were reduced with the SH diet compared with the CON and DCP diets. Overall, these results clearly showed, for the first time, that low-starch/high-NDF diets are not able to prevent the establishment of -10 shifted rumen biohydrogenation pathways, evaluated by the deposition of biohydrogenation intermediates in lamb meat and fat.

show abstract

Section: Gene Expressionmentioning

confidence: 99%

Section: Gene Expressionmentioning

confidence: 99%

The reduction of starch in finishing diets supplemented with oil does not prevent the accumulation of trans-10 18:1 in lamb meat1

Costa

Alves

Francisco

et al. 2017

Journal of Animal Science

Self Cite

View full text Add to dashboard Cite

show abstract

“…Thus, oilseeds and their oils are considered as alternative and sustainable sources of n-3 PUFA. Canola and flaxseed oils contain an abundance of α- linoleic acid (ALA, 18:3n-3) [12] and have been of recent interest in a few feeding trials aiming to increase n-3 PUFA levels in lamb [13–15]. However, these investigations mainly focused on variations in meat fatty acid profiles of lambs fed vegetable oils.…”

Section: Introductionmentioning

confidence: 99%

Correlations between growth and wool quality traits of genetically divergent Australian lambs in response to canola or flaxseed oil supplementation

Malau‐Aduli

Nguyen

et al. 2019

PLoS ONE

View full text Add to dashboard Cite

The correlations between growth and wool traits in response to canola and flaxseed oil supplementation were evaluated in Australian prime lambs. Sixty dual-purpose prime lambs including purebred Merino and crossbred lambs were allocated to one of five treatments of lucerne hay basal diet supplemented with isocaloric and isonitrogenous wheat-based pellets. Treatments were: no oil inclusion (Control); 2.5% canola oil; 5% canola oil; 2.5% flaxseed oil and 5% flaxseed oil, with lamb groups balanced by breed and gender. Each lamb was daily supplemented with 1kg of pellets and had free access to lucerne hay and water throughout the 7-week feeding trial, after a 3-week adaptation. Individual animal basal and supplementary pellet feed intakes were recorded daily, while body conformation traits, body condition scores and liveweights were measured on days 0, 21, 35 and 49. The lambs were dye-banded on the mid-side and shorn before commencing the feeding trial and mid-side wool samples were collected from the same dye-banded area of each lamb at the end of the experiment. Correlations between wool quality traits and lamb performance were non-significant (P>0.05). Oil supplementation had no detrimental effect on lamb growth and wool quality traits (P > 0.05). Gender significantly affected wither height gain and fibre diameter. There were significant interactions between oil supplementation and lamb breed on chest girth. The correlations between clean fleece yield (CFY) and other wool quality traits were moderate ranging from 0.29 to 0.55. Moderate to high correlations between fibre diameter (FD) and other wool quality traits were detected (0.46–0.99) with the strongest relationship between FD and wool spinning fineness (SF). The relationship between CFY and wool comfort factor (CF) were positive, while negative relationships between CFY and the others were observed. A combination of 5% oil supplementation and genetics is an effective and strategic management tool for enhancing feed efficiency and growth performance without negative effects on wool quality in dual-purpose lamb production. This is a good outcome for dual-purpose sheep farmers. It essentially means the absorbed nutrients in supplemented lambs yielded good growth performance without any detrimental impact on wool quality; a win-win case of nutrient partitioning into the synthesis of muscle and wool without compromising either traits.

show abstract

“…The main way of improving the PUFA content in ruminants is the supplementation of PUFA enriched plant oils in their diets [ 8 , 9 ]. Canola and flaxseed oils, which contain an abundance of α-linoleic acid (ALA, 18:3 n -3) [ 10 , 11 ], have been of recent interest in numerous nutritional trials in order to mainly improve n -3 LC-PUFA contents including eicosapentaenoic acid (EPA, 20:5 n -3), docosapentaenoic acid (DPA, 22:5 n -3) and docosahexaenoic acid (DHA, 22:6 n -3) in sheep meat [ 12 , 13 , 14 , 15 ]. Genetic management of livestock for enhancing n -3 LC-PUFA content through selective breeding provides an alternative to nutritional manipulation and it is a cumulative and long-term approach.…”

Section: Introductionmentioning

confidence: 99%

Omega–3 Long-Chain Fatty Acids in the Heart, Kidney, Liver and Plasma Metabolite Profiles of Australian Prime Lambs Supplemented with Pelleted Canola and Flaxseed Oils

Nguyen

Nguyễn

et al. 2017

Nutrients

View full text Add to dashboard Cite

The objective of the study was to ascertain whether human health beneficial omega–3 long-chain (≥C20) polyunsaturated fatty acid (n-3 LC-PUFA) content in heart, kidney and liver can be enhanced by supplementing prime lambs with graded levels of canola and flaxseed oil. Health status of the lambs, as a consequence of the supplementation, was also investigated by examining their plasma metabolites. Sixty purebred and first-cross lambs were allocated to one of five treatments of lucerne hay basal diet supplemented with isocaloric and isonitrogenous wheat-based pellets without oil inclusion (Control) or graded levels of canola oil at 2.5% (2.5C), 5% (5C), flaxseed oil at 2.5% (2.5F) and 5% (5F) in a completely randomised design. Pre-slaughter blood, post-slaughter kidney, liver and heart samples were analysed for plasma metabolite and fatty acid profiles. Summations of docosapentaenoic acid and docosahexaenoic acid, and total n-3 LC-PUFA were enhanced in the liver and kidney of 5F supplemented lambs with a marked decrease in n-6/n-3 ratio and significant breed differences detected. There were generally no deleterious impacts on animal health status. A combination of 5% oil supplementation and lamb genetics is an effective and strategic management tool for enhancing n-3 LC-PUFA contents of heart, kidney and liver without compromising lamb health.

show abstract

Effect of feeding lambs with a tanniferous shrub (rockrose) and a vegetable oil blend on fatty acid composition of meat lipids

Cited by 23 publications

References 33 publications

The reduction of starch in finishing diets supplemented with oil does not prevent the accumulation of trans-10 18:1 in lamb meat1

The reduction of starch in finishing diets supplemented with oil does not prevent the accumulation of trans-10 18:1 in lamb meat1

Correlations between growth and wool quality traits of genetically divergent Australian lambs in response to canola or flaxseed oil supplementation

Omega–3 Long-Chain Fatty Acids in the Heart, Kidney, Liver and Plasma Metabolite Profiles of Australian Prime Lambs Supplemented with Pelleted Canola and Flaxseed Oils

Contact Info

Product

Resources

About