Effect of combination sildenafil and gemfibrozil on cisplatin-induced nephrotoxicity; role of heme oxygenase-1

Abstract

Background/aim: Cisplatin-induced nephrotoxicity in large proportion of patients. The aim of this work is to clarify the effect of combination of sildenafil and gemfibrozil on cisplatin-induced nephrotoxicity either before or after cisplatin treatment and determination of nephrotoxicity predictors among the measured tissue markers.Methods: Thirty two adult male albino rats were divided into four equal groups (G) GI control, GII received cisplatin, GIII received sildenafil and gemfibrozil before cisplatin, GIV received sildenafil and gemfibrozil after cisplatin. Creatinine and urea were measured and animals were sacrificed and kidney was taken for histopathology. The following tissue markers were measured, heme oxygenase-1 (HO-1) activity, reduced glutathione, quantitative (real-time polymerase chain reaction) RT-PCR for gene expression of tumor necrosis factor alpha (TNF-α) and endothelial nitric oxide synthase (ENOS) level.Results: GII developed AKI demonstrated by significantly high urea and creatinine and severe diffuse (80–90%) tubular necrosis. TNF-α was highly and significantly elevated while the rest of tissue markers were significantly reduced in GI1 compared to other groups. GIV showed better results compared to GIII. There was a significant positive correlation between creatinine and TNF-α when combining GI and GII while there were significant negative correlation between creatinine and other tissue markers in same groups. Linear regression analysis demonstrated that HO-1 was the independent predictor of AKI demonstrated by elevated creatinine among GI and GII.Conclusions: Combination of sildenafil and gemfibrozil can be used in treatment of cisplatin-induced nephrotoxicity. HO-1 is a promising target for prevention and/or treatment of cisplatin-induced nephrotoxicity.

Protective effect of avenanthramides against cisplatin induced nephrotoxicity in rats

“…CP administration resulted in an increased level of TNF-α when compared to the control group. This is in agreement with the previous investigations [28–30]. Ma et al [11] found that the administration of CP produced a significant increase in TNF-α and IL-6.…”

Modulation of NADPH oxidase and Nrf2/HO-1 pathway by vanillin in cisplatin-induced nephrotoxicity in rats

“…Vanillin pretreatment prevented CP‐induced kidney damage and preserved kidney function in accordance with previous studies. [ 11,12,30 ]…”

“…The forward and reverse primer sequences were as follow: NOX‐4 : forward (5′‐TTCTGGACCTTTGTGCCTATAC‐3′) and reverse (5′‐CCATGACATCTGAGGGATGATT‐3′), [ 26 ] NRF‐2 : forward (5′‐ACGGTGGAGTTCAATGAC‐3′) and reverse (5′‐GAAGAATGTGTTGGCTGTG‐3′), [ 27 ] HO‐1 : forward (5′‐GCCTGCTAGCCTGGTTCAAG‐3′) and reverse (5′‐AGCGGTGTCTGG GATGAACTA‐3′), [ 27 ] GAPDH : forward (5′‐CACCCTGTTGCTGTAGCCATATTC‐3′) and reverse (5′‐GACATCAAGAAGGTGG TGAAGCAG‐3′). [ 12 ]…”

“…[ 10 ] Nrf2/HO‐1 signalling pathway was reported as a crucial target of antioxidant and cytoprotective agents in cisplatin nephrotoxicity. [ 11,12 ]…”

Greetings to the readers

“…Along with human studies, the Journal has published important works on animal models of AKI as well. These have included work on the potential protective role of N-acetylcysteine in oxalateinduced AKI in a rat model [13], the protective effect of berberine against gentamycin-induced nephrotoxicity in rats [14] and its possible underlying mechanisms, and explored the protective role of heme oxygenase-1 on the course of cisplatin-induced nephrotoxicity [15].…”