Effect of calcination temperature on Co(II) oxalate dihydrate–iron(II) oxalate dihydrate mixture

Gabal, M.A.; El-Bellihi, A.A.; Ata‐Allah, S.S.

doi:10.1016/s0254-0584(03)00137-8

Cited by 61 publications

(35 citation statements)

References 28 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…This band is indicative of the presence of a minor -Fe 2 O 3 phase as confirmed by X-ray diffraction analysis (Figure 1(c)). A marked decrease in the height of 3700, 2359, 1716, and 1450 bands with increasing the temperature to 600 ∘ C is due to the decomposition of all the organic residues (Figure 2(d)) [2,19]. The characteristic spinel ferrite bands at 858 and 545 cm −1 are still present.…”

Section: Fourier Transform Infrared Spectroscopy (Ftir) Analysismentioning

confidence: 94%

“…The characteristic small bands at 1716 and 1338 cm −1 are assigned to both asymmetric and symmetric C-O, respectively [2,19,21]. The C-O bands region is an indicative of the presence of organic residues due to acetylacetone species [21].…”

Section: Fourier Transform Infrared Spectroscopy (Ftir) Analysismentioning

confidence: 99%

“…Based on this feature, one can explain the dependence of particle size on cation stoichiometry [5]. Figure 2 shows the FTIR spectra of both -Fe 2 O 3 and CdFe 2 O 4 powders thermally treated at 500 ∘ and 600 ∘ C for 3 h. Figure 2(a) shows the spectrum of F500 powder: a broad band at 3742 cm −1 that is assigned to the adsorbed H 2 O from the atmosphere or OH group of isopropanol is observed [19,20].…”

Section: X-ray Diffraction (Xrd) Analysismentioning

confidence: 99%

“…The C-O bands region is an indicative of the presence of organic residues due to acetylacetone species [21]. Two small peaks appeared at 533 and 440 cm −1 that are characteristic of poorly crystallineFe 2 O 3 [19].…”

Section: Fourier Transform Infrared Spectroscopy (Ftir) Analysismentioning

confidence: 99%

See 3 more Smart Citations

Preparation and Characterization of Nano-Cadmium Ferrite

Ismail

Labib

Attallah

2013

Journal of Ceramics

View full text Add to dashboard Cite

Nano-hematite ( -Fe 2 O 3 ) and nano-cadmium ferrite (CdFe 2 O 4 ) are prepared using template-assisted sol-gel method. The prepared samples are analyzed using X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FTIR), scanning electron microscopy (SEM), and Mössbauer spectroscopy techniques for structural and microstructural studies. Nano--Fe 2 O 3 with particle size ∼60 nm is formed at 500 ∘ C, while nano-CdFe 2 O 4 with smaller particle size (∼40 nm) is formed at 600 ∘ C. It is found that with a simple solgel process we can prepare nano-CdFe 2 O 4 with better conditions than other methods: pure phase at lower sintering temperature and time (economic point) and of course with a smaller particle size. So, based on the obtained experimental results, a proposed theoretical model is made to explain the link between the use of the sol-gel process and the formation of nano-CdFe 2 O 4 as a pure phase at low temperature. This model is based on a simple magnetostatic interaction between the formed nuclei within the solution leading to the formation of the stable phase at low temperature.

show abstract

Section: Fourier Transform Infrared Spectroscopy (Ftir) Analysismentioning

confidence: 94%

Section: Fourier Transform Infrared Spectroscopy (Ftir) Analysismentioning

confidence: 99%

Section: X-ray Diffraction (Xrd) Analysismentioning

confidence: 99%

Section: Fourier Transform Infrared Spectroscopy (Ftir) Analysismentioning

confidence: 99%

See 2 more Smart Citations

Preparation and Characterization of Nano-Cadmium Ferrite

Ismail

Labib

Attallah

2013

Journal of Ceramics

View full text Add to dashboard Cite

show abstract

“…The kinetics of the thermal decomposition process were carried out using isothermal and dynamic thermogravimetric means and considered in light of various models and computational methods of solid state reactions (3)(4)(5)(6)(7)(8)(9)(10)(11)(12) . The kinetic analysis of dynamic TG data were discussed in view of three integral methods suggested by Ozawa (13) , Coats-Redfern (14) , and Diefallah's composite method (5) and the results were compared with those obtained under isothermal conditions .…”

mentioning

confidence: 99%

Kinetics of Thermal Decomposition of Iron Carbonate

2010

Egypt. J. Chem.

View full text Add to dashboard Cite

HE THERMAL decomposition of iron cabonate in air was ……studied by means of DTA-TG, XRD, SEM and Mossbauer measurements. The kinetics of the thermal decomposition process were studied using isothermal and non-isothermal thermogravimetric techniques. The results show that the thermal decomposition proceeds in one step to iron oxide. Kinetic analysis of isothermal data of the decomposition reaction in the light of various solid state reaction models revealed that the reaction is best described by the diffusion models. Kinetic analysis of the dynamic TG curves were discussed with reference to Diefallah's composite integral method, in comparison with the integral methods due to Coats-Redfern and to Ozawa. The activation parameters were calculated and the results of the isothermal and dynamic integral methods which were compared to each other were discussed.Progress in an increasing number of areas of technology and hence industry is being recognized as directly related to understanding the factors influencing reactivity of solids and how they react (1) . Thermoanalytical methods have been used extensively for studying the kinetics of thermal decomposition of solids. The kinetic studies have proceeded in two directions: using powdered materials and using single crystals. The former studies are much more extensive than the latter. The essential features of solids-state decompositions are: the destruction of the crystal lattice of the reactant, the breaking and the redistribution of chemical bonds followed by the formation of the crystal lattice of the reaction product and lastly, the diffusion of one component or the other through the product layer of the propagation of the dissociation reaction. The kinetics of thermal decomposition of solids are affected by experimental factors (2) , such as heating rate, particle size, sample mass and holder design.Iron carbonate (FeCO 3 ) exists commonly in the rock (siderite core). It plays a major role in biogeochemical cycles as electron donor and acceptor in oxidationreduction reactions.

show abstract

Identification of DNA methylation by novel optical genosensing: A new platform in epigenetic study using biomedical analysis

Aghaei

Dehghan

Hasanzadeh

et al. 2021

J of Molecular Recognition

View full text Add to dashboard Cite

Due to the important role of methylation in cancer, the use of sensitive analytical methods for early diagnosis and efficient clinical pharmacotherapy is highly demanded. In this study, an innovative label‐free method has been developed for the recognition of methylated DNA in the promoter area of adenomatous polyposis coli gene (APC gene). Also, differentiation of unmethylated DNA (GCGGAGTGCGGGTCGGGAAGCGGA) from methylated cDNA (GC(M)GGAGTGC(M)GGGTC(M)GGGAAGC(M)GGA) was performed using optical synthesized probe (thionine‐based polymer). Hybridization of pDNA (TCCGCTTCCCGACCCGCACTCCGC) with various types of cDNA sequences was studied by UV‐visible and fluorescence spectroscopy. Also, some of the mismatch sequences {(GC(M)GGAGTAC(M)GGGTC(M)GGGAAGC(M)GGA) and (GCGGAGTACGGGTCGGGAAGCGGA)} were applied as negative control. For this purpose, The synthesized optical probe was characterized by transmission electron microscopy, atomic force microscopy, dynamic light scattering, zeta potential, energy dispersive X‐ray spectroscopy, Fourier transform infrared spectroscopy, UV‐Vis, and fluorescence spectroscopy. Under optimal conditions, the analytical performance of engineered DNA‐based assay was studied and exhibited excellent dynamic range (1 zM to 3 pM) with low limit of quantitation (LLOQ) of 1 zM. The designed DNA‐based assay showed a high capability of discriminating methylation, unmethylated and mismatched sequences. The engineered genosensor is simple and inexpensive and can detect DNA methylation with high sensitivity. Therefore, the designed geno‐assay could detect DNA methylation significantly and discriminate from unmethylated DNA. It is expected that the proposed geno‐assay could be used for the detection of DNA methylation, genetic mutations, epigenetic alterations, and early stage diagnosis of various cancer toward efficient clinical pharmacotherapy.

show abstract

Effect of calcination temperature on Co(II) oxalate dihydrate–iron(II) oxalate dihydrate mixture

Cited by 61 publications

References 28 publications

Preparation and Characterization of Nano-Cadmium Ferrite

Preparation and Characterization of Nano-Cadmium Ferrite

Kinetics of Thermal Decomposition of Iron Carbonate

Identification of DNA methylation by novel optical genosensing: A new platform in epigenetic study using biomedical analysis

Contact Info

Product

Resources

About