Effect of Bcl-2 and Bax on survival of side population cells from hepatocellular carcinoma cells

Abstract

AIM:To understand the role and significance of side population (SP) cells from hepatocellular carcinoma (HCC) in hepatocarcinogenesis, development, relapse and metastasis, we simulated the denutrition conditions that cancer cells experience in clinical therapy, observed the different anti-apoptosis ability of SP cells and non-SP cells under such conditions, and established the possible effects of P53, Bcl-2 and Bax on survival of SP cells. METHODS:We used flow cytometry to analyze and sort the SP and non-SP cells in established HCC lines MHCC97 and hHCC. We evaluated cell proliferation by methyl thiazolyl tetrazolium (MTT) assay and investigated the expression of p53, bcl-2 and bax genes during denutrition, by RT-PCR and immunofluorescence staining. RESULTS:The percentage of SP cells in the two established HCC lines was 0.25% and 0.5%, respectively. SP cells had greater anti-apoptosis and proliferation ability than non-SP cells. Expression of Bcl-2 and Bax in SP and non-SP cells differed during denutrition. The former was up-regulated in SP cells, and the latter was up-regulated in non-SP cells. CONCLUSION:It may be that different upstream molecules acted and led to different expression levels of Bcl-2 and Bax in these two cell lines. There was a direct relationship between up-regulation of Bcl-2 and down-regulation of Bax and higher anti-apoptosis ability in SP cells. It may be that the existence and activity of SP cells are partly responsible for some of the clinical phenomena which are seen in HCC, such as relapse or metastasis. Further research on SP cells may have potential applications in the field of anticancer therapy.

Effect of PAK1 gene silencing on proliferation and apoptosis in hepatocellular carcinoma cell lines MHCC97-H and HepG2 and cells in xenograft tumor

“…Bcl-2 gene family is essential for cell apoptosis regulation, where Bcl-2 acts as an anti-apoptosis factor and Bax as an pro-apoptosis factor [19]. In a recent study, the up-regulated Bcl-2 and down-regulated Bax were effective in side population cells during anti-apoptosis in hepatocarcinogenesis, which indicated that up-regulated Bcl-2 had a direct relationship with down-regulated Bax and increased anti-apoptosis ability in side population cells [20]. As reflected in our study, expressions of p21 and p53 were increased, while expressions of Cyclin E and CDK2 were decreased in the PAK1 shRNA group.…”

“…Moreover, the downregulation of CDK4/(and CDK6)/D-type cyclin complexes and CDK2/cyclin E (and cyclin A) complexes mediate p21dependent inhibition of cell cycle progression from G1 to S phases [22]. P53, the most common mutated gene in human malignancies, was named the "guardian of the genome" [20]. According to the previous study, p21 WAF1/CIP1 expression seems to be mainly associated with altered p53 in HCV-related HCC and malignant progression of HCC was due to the block of the p53-p21 WAF1/CIP1 cell cycleregulating pathway [23].…”

Aberrantly elevated redox sensing factor Nrf2 promotes cancer stem cell survival via enhanced transcriptional regulation of ABCG2 and Bcl-2/Bmi-1 genes

“…Furthermore, we have shown that silencing of the Nrf2 gene expression attenuated the expression of ABCG2, Bcl-2 and Bmi-1, rendering the SP cells more sensitive to drug treatment and efficiently subjected to apoptosis. There is a high risk of alteration in programmed cell death during carcinogenesis associated with mutation in the p53 gene and modulation of apoptotic regulatory Bcl-2, Bmi-1 and Bax proteins in cervical CSCs (18). Inactivation of the p53 gene induces the production of other pro-apoptotic proteins such as Bax and represses the anti-apoptotic factors such as Bcl-2 and Bmi-1 (18).…”

“…There is a high risk of alteration in programmed cell death during carcinogenesis associated with mutation in the p53 gene and modulation of apoptotic regulatory Bcl-2, Bmi-1 and Bax proteins in cervical CSCs (18). Inactivation of the p53 gene induces the production of other pro-apoptotic proteins such as Bax and represses the anti-apoptotic factors such as Bcl-2 and Bmi-1 (18). Therefore, we hypothesized that an elevated level of Nrf2 may be involved in the inactivation of the p53 gene and its function.…”

“…RT-qPCR analysis was performed on an iCycler IQ real-time detection system, using an IQ Supermix with SYBR-Green (both from Bio-Rad, Hercules, CA, USA). The sequences of human specific primers used were as follows (15,16): ABCG2 forward, TCA ATC AAA GTG CTT CTT TTT TATG and reverse, TTG TGG AAG AAT CAC GTG GC); Nrf2 forward, ACA CGG TCC ACA GCT CAT C and reverse, TGC CTC CAA AGT ATG TCA ATC A); GAPDH forward, ATG TCG TGG AGT CTA CTG GC and reverse, TGA CCT TGC CCA CAG CCT TG); Oct-4 forward, TCG AGA ACC GAG TGA GAG GC and reverse, CAC ACT CGG ACC ACA TCC TTC); Bmi-1 forward, CTCCCAACTGGTTCGACCTT and reverse, CGGTTTCCATATTTCTCAGT); CD133 forward, TCT TGA CCG ACT GAG AC and reverse, ACT TGA TGG ATG CAC CAA GCA C); epCAM forward, CTG CCA AAT GTT TGG TGA TG and reverse, ACG CGT TGT GAT CTC CTT CT); BCl-2 forward, ACA CTG TTA AGC ATG TGC CG and reverse, CCA GCT CAT CTC ACC TCA CA); and Bax forward, GGA TGC GTC CAC CAA GAA and reverse, ACT CCC GCC ACA AAG ATG) (17)(18)(19)(20). The PCR parameters used to set the PCR reactions were: Initial denaturation at -95˚C for 15 sec; annealing at -58˚C for 45 sec; and extension at -60˚C for 30-45 sec, for 35 cycles.…”