Effect of antiviral treatment in patients with chronic HCV infection and t(14;18) translocation

Abstract

Hepatitis C virus (HCV) may be associated with the mixed cryoglobulinemia syndrome and other B-cell lymphoproliferative disorders (LPDs). The t(14;18) translocation may play a pathogenetic role. Limited data are available regarding the effects of antiviral therapy on rearranged B-cell clones. We evaluated the effects of interferon and ribavirin on serum, B-lymphocyte HCV RNA, and t(14; 18) in 30 HCV ؉ , t(14;18) ؉ patients without either mixed cryoglobulinemia syndrome or other LPDs. The t(14;18) translocation was analyzed by both bcl-2/J H polymerase chain reaction and bcl-2/J H junction sequencing in peripheral blood mononuclear cells in all patients. Fifteen untreated patients with comparable characteristics served as controls. Throughout the study, the presence or absence of both t(14;18) and HCV RNA sequences were, in most cases, associated in the same cell samples. At the end of treatment, t(14;18) was no longer detected in 15 patients (50%) with complete or partial virologic response, whereas it was persistently detected in nonresponders (P < .05), as well as in 14 of 15 control patients. In 4 responder patients, t(14;18) and HCV RNA sequences were no longer detected in blood cells after treatment, but were again detected after viral relapse; the same B-cell clones were involved in the pretreatment and posttreatment periods. In conclusion, this study suggests that antiviral therapy may induce regression of t(14;18)-bearing Bcell clones in HCV ؉ patients and that this phenomenon may be related, at least in part, to the antiviral effect of therapy. This in turn suggests that antiviral treatment may help prevent or treat HCV-related

Lacrimal Gland Marginal Zone Lymphoma: Regression after Treatment of Chronic Hepatitis C Virus Infection: Case Report and Review of the Literature

“…Furthermore, the reappearance of translocated B-lymphocyte clones is observed in patients whose HCV infection initially responded to interferon treatment and then relapsed. This confirms the hypothesis that the expanded B-lymphocyte clone needs persistent treatment of the infective stimulus (25)(26)(27).…”

Splenic lymphoma with villous lymphocytes, associated with type II cryoglobulinemia and HCV infection: a new entity?

“…These findings contrast with previous reports stating the disappearance of B-cell clones in the blood of HCV-infected patients after antiviral therapy. [14][15][16] This discrepancy may reflect differences in tumor load or in survival requirements. In the case of SLVL, some clones, though remaining antigendependent for their proliferation, may survive in the favorable environment of the spleen or bone marrow, even after effective clearance of HCV.…”

Hepatitis C virus RNA localization in human carotid plaques

“…One microgram of total RNA was retro-transcribed in the presence of antisense primers for HCV 5 non-coding region (5 NCR) and human GAPDH gene. HCV RNA sequences were detected by home-made qualitative nested RT-PCR (sensitivity: 1-5 HCV IU/mL) 24,25 ; uracyl-N-glycosilase (1 U/sample) was added to the reaction mixture to avoid carryover of PCR products. GAPDH gene was amplified with sense (ACCACAGTCCATGCCAT-CAC) and antisense (TCCACCACCCTGTTGCTGTA) primers using the following protocol: denaturation step of 4 min at 95 • C followed by 30 cycles at 95 • C for 20 s, 55 • C for 25 s and 72 • C for 25 s.…”