Effect of acrylamide on glucose homeostasis in female rats and its mechanisms

Yue, Zonghao; Chen, Yanjuan; Song, Yanjun; Zhang, Jie; Yang, Xing-Dong; Wang, Jian; Li, Lili; Sun, Zhongke

doi:10.1016/j.fct.2019.110894

Cited by 43 publications

(53 citation statements)

References 41 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…[48] AKT activation may suppress FoxO1 expression, and inhibition of the PI3K/Akt pathway could attenuate the role of AKT on the transcription of FoxO1 and FoxO1-mediated enzymes. [44] In the current study, we observed a significant reduction in plasma insulin levels and a downregulation of the hepatic mRNA levels of IRS-1, PI3K, and AKT, and also a decrease in hepatic p-Akt/Akt and p-PI3K/PI3K in the HOP group mice. These results indicate that HOP intake can cause damage to the insulin signal pathway downstream of the insulin receptor.…”

Section: Discussionsupporting

confidence: 62%

“…[42] PEPCK and G6Pase are two key enzymes involved in the decarboxylation of oxaloacetate and the dephosphorylation of glucose-6-phosphate during gluconeogenesis, respectively. [43,44] FoxO1 is the major transcriptional activator that stimulates the expression of G6Pase and PEPCK. [45] The absence of FoxO1 in the liver downregulated the expression of G6Pase and PEPCK, and it decreased the concentration of fasting blood glucose in mice.…”

Section: Discussionmentioning

confidence: 99%

“…[47] In this process, insulin first binds to its receptor, and then, it activates the IRS/PI3K/Akt pathway and regulates a chain of downstream signal molecules. [44] This leads to changes in gene expression and activity of critical enzymes during glycometabolism. [48] AKT activation may suppress FoxO1 expression, and inhibition of the PI3K/Akt pathway could attenuate the role of AKT on the transcription of FoxO1 and FoxO1-mediated enzymes.…”

Section: Discussionmentioning

confidence: 99%

See 2 more Smart Citations

Oxidized Pork Induces Disorders of Glucose Metabolism in Mice

Yang

et al. 2021

Molecular Nutrition Food Res

View full text Add to dashboard Cite

Scope Consumption of red meat, particularly processed red meat, has been reported to be associated with type 2 diabetes risk, and oxidized proteins and amino acids may be involved in this process. This study explores the effects of pork with varying degrees of oxidative injury caused by cooking on glucose metabolism in mice. Methods and results Cooked pork is freeze‐dried to prepare animal feed. Mice are fed either a control diet (CON), a low‐ (LOP), or a high‐oxidative injury pork diet (HOP) for 12 weeks. Intake of HOP causes hyperglycemia, hypoinsulinemia, and impaired glucose tolerance, indicating a glucose metabolism disorder. Accumulation of oxidation products increases oxidative stress and inflammatory response, which impairs pancreatic islet β cells function and reduces insulin secretion. Moreover, HOP‐mediated hyperglycemia can be partly attributed to elevated hepatic glucose output, as indicated by increased gluconeogenesis and glycogenolysis, and decreased glycolysis and glycogen content. Changes in these processes may be regulated by reduced insulin levels and suppression of the insulin receptor substrate‐1 (IRS‐1)/phosphoinositide 3‐kinase (PI3K)/protein kinase B (Akt) signaling pathway and its downstream signaling molecules. Conclusion HOP intake induces disorders of glucose metabolism by impairing pancreatic insulin secretion and increasing hepatic glucose output. Protein oxidation plays a key role in abnormal glucose metabolism induced by HOP.

show abstract

Section: Discussionsupporting

confidence: 62%

Section: Discussionmentioning

confidence: 99%

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

Oxidized Pork Induces Disorders of Glucose Metabolism in Mice

Yang

et al. 2021

Molecular Nutrition Food Res

View full text Add to dashboard Cite

show abstract

“…On a study of the effect of ACR on female rats, Yue et al (2020) reported depletion of hepatic glycogen and increased glycogen phosphorylase; the latter promotes glycogenolysis leading to decreased glycogen storage in the liver.…”

Section: Discussionmentioning

confidence: 99%

Role of Ascorbic Acid Versus Silymarin in Amelioration of Hepatotoxicity Induced by Acrylamide in Adult Male Albino Rats: Histological and Immunohistochemical Study

2020

View full text Add to dashboard Cite

Acrylamide (ACR) is a cytotoxic and carcinogenic material. It is a product of a Maillard reaction during the cooking of many types of fried fast food, e.g. potato chip fries, and chicken nuggets. ACR has a severe toxic effect on different body organs. This study investigates the hepatotoxic effect of ACR, and the protective effect of ascorbic acid and silymarin. For this purpose, forty adult, male, albino rats were divided into four groups and received the following treatments for fourteen days: Group I: (the control) normal saline; Group II: ACR only; Group III: ACR and ascorbic acid; and Group IV: ACR and silymarin. Under a light microscope, the liver from rats treated with ACR only presented disturbed liver architecture, degenerated hepatocytes, reduced glycogen contents, congested central vein, and increased collagen fibres with areas of fibrosis. Immunohistochemical examination revealed an increased mean number of CD68-, and α-SMA-positive cells. This indicates the presence of large numbers of stellate macrophages (Kupffer cells) and Hepatic stellate cells (HSCs). The combination of ACR with either ascorbic acid or silymarin resulted in less hepatic degeneration, less fibrosis and fewer CD68 and α-SMA positive cells compared to the ACR only group. In conclusion, treatment with silymarin or ascorbic acid along with ACR appears to alleviate ACR-induced hepatotoxicity with more protection in silymarin treated rats.

show abstract

“…We wonder whether such a calculation is appropriate, as the sensitivity to a reagent in rats and humans is often different. In toxicological studies, the sensitivity index between humans and rats is 6.25 in common [12]. Therefore, we call more attention to the method and conclusion.…”

mentioning

confidence: 99%

Comment on Experimental Determination of the Threshold Dose for Bifidogenic Activity of Dietary 1-Kestose in Rats. Foods 2020, 9, 4

Shen

Yang

Sun

2020

Foods

Self Cite

View full text Add to dashboard Cite

Currently, our group is undertaking a program trying to evaluate the bifidogenic effect/activity of different prebiotics and their dose-effect relationships. Therefore, we were interested to read an article reported the determination of the minimal threshold dose for the bifidogenic activity of dietary 1-kestose in rats published in Foods in December 2019 [1]. It was reported that Bifidobacterium spp. preferentially metabolized fructo-oligosaccharides (FOSs) with a lower degree of polymerization [2]. As the major component of FOSs with the smallest molecular weight, determination of its minimal threshold dose for the bifidogenic activity of 1-kestose in foods is definitely important. However, we have some concerns, especially on the methodological drawbacks, which may be critical to this report.Watanabe et al. measured cecal microbiota populations using quantitative real-time polymerase chain reaction (qPCR) technology [1]. The 16S rRNA was amplified as a target gene for quantification of Bifidobacterium spp. using a pair of primers (F: GATTCTGGCTCAGGATGAACGC; R: CTGATAGGACGCGACCCCAT). The authors provided a reference (Reference 8) for the primers. However, we noticed that paper enumerated Bifidobacterium spp. by traditional cell counting on agar plate other than qPCR amplification [3]. It is obvious the citation is incorrect.Then, we found the above primers in another paper, which came from the same research group, in which a similar experiment was conducted investigating the effect of 1-kestose within a range of 0.5-5.0% [4]. In this paper, the primers have the same sequences but different names (Bif LM26F/Bif 228R). Although it was primarily designed based only on the corresponding gene of Bifidobacterium longum subsp. longum JCM 1217 T (B. longum), this pair of primers was used as the Bifidobacterium genus specific primer. In fact, the primers (Bif LM26F/Bif 228R) were first designed in 2004 [5]. The applicability/university of the primers was evaluated with 10 type strains of Bifidobacterium spp., representing 10 different species. The specificity of the primers was checked with 21 type strains of nonbfidobacerial strains. Thereafter, the primers were used in many studies. However, we now know there are more than 88 species in the genus of Bifidobacterium and the diversity of gut microbiota is quite high [6]. Therefore, we wonder whether the primers are reliable for genus-specific amplification.To support our speculation, we performed a specificity check of this pair of primers using Primer-BLAST with default settings [7]. Results produced online indicate both the specificity and universality of this pair of primers are questionable. According to this prediction, the primers yield 230 bp amplicons from different genera of bacteria, targeting the 16S rRNA gene. It was equally efficient for Gardnerella spp., Scardovia inopinata, and Parascardovia denticolens, albeit could amplify many species of Bifidobacterium spp. Unfortunately, representatives of these bacteria were not included in the original study [5]. E...

show abstract

Effect of acrylamide on glucose homeostasis in female rats and its mechanisms

Cited by 43 publications

References 41 publications

Oxidized Pork Induces Disorders of Glucose Metabolism in Mice

Oxidized Pork Induces Disorders of Glucose Metabolism in Mice

Role of Ascorbic Acid Versus Silymarin in Amelioration of Hepatotoxicity Induced by Acrylamide in Adult Male Albino Rats: Histological and Immunohistochemical Study

Comment on Experimental Determination of the Threshold Dose for Bifidogenic Activity of Dietary 1-Kestose in Rats. Foods 2020, 9, 4

Contact Info

Product

Resources

About