EF-G Activation by Phosphate Analogs

Abstract

EF-G is a universally conserved translational GTPase that promotes the translocation of tRNA and mRNA through the ribosome. EF-G binds to the ribosome in a GTP-bound form and subsequently catalyzes GTP hydrolysis. The contribution of the ribosome-stimulated GTP hydrolysis by EF-G to tRNA/mRNA translocation remains debated. Here, we show that while EF-G•GDP does not stably bind to the ribosome and induce translocation, EFG• GDP in complex with phosphate group analogues BeF3− and AlF4− promotes the translocation of tRNA and mRNA. Furthermore, the rates of mRNA translocation induced by EF-G in the presence of GTP and a non-hydrolysable analogue of GTP, GDP•BeF3−are similar. Our results are consistent with the model suggesting that GTP hydrolysis is not directly coupled to mRNA/tRNA translocation. Hence, GTP binding is required to induce the activated, translocation-competent conformation of EF-G while GTP hydrolysis triggers EF-G release from the ribosome.

Extending the spacing between the Shine-Dalgarno sequence and P-site codon reduces the rate of mRNA translocation

“…Time traces were analyzed using Origin (OriginLab Corporation, Northampton, MA). As reported previously [26,30,31,33], the kinetics of mRNA translocation are clearly biphasic and are best fitted to the sum of two exponentials (y=y0+A1*exp(-k1*t)+A2*exp(-k2*t)), corresponding to the apparent rate constants k1 and k2.…”

“…Fluorescein labeled mRNAs were synthesized by Integrated DNA Technologies (Coralville, IA). mRNA variants were derived from the mRNA with 4-nucleotide spacer between SD and AUG codon [33]…”

Extending the Spacing between the Shine–Dalgarno Sequence and P-Site Codon Reduces the Rate of mRNA Translocation

“…To determine the rate of mRNA translocation directly, we measured fluorescence quenching of a fluorescein dye attached to the 3' end of short model mRNAs as they move within the ribosome. This fluorescence quenching translocation assay was extensively used before [26,[32][33][34].…”

“…Fluorescein labeled mRNAs were synthesized by Integrated DNA Technologies (Coralville, IA). mRNA variants were derived from the mRNA with 4-nucleotide spacer between SD and AUG codon [33] (5' GGCAAGGAGGUAAAAAUGUACAAAGUAUAA 3' Fluorescein; SD sequence and AUG codon are underlined): 5' GGCAAGGAGGUACACAAAUGUACAAA 3'Fluorescein (6 nt spacer); 5' GGCAAGGAGGUACACAAAAUGUACAAA 3'Fluorescein (7 nt spacer); 5' GGCAAGGAGGUACAACACAAAAUGUACAAA 3'Fluorescein (10 nt spacer); 5' GGCAAGGAGGUAACAACACAAACAAAUGUACAAA 3'Fluorescein (14 nt spacer). We also measured the rate of translocation of leaderless mRNA (5' AUGUACAAAGUAUAA 3' Fluorescein) that does not contain SD sequence.…”

Translocation as continuous movement through the ribosome

“…22,48 On the other hand, interfering with Pi release by introducing mutations in ribosomal protein L12 or mimicking the Pi-bound state by adding Pi analogs does not block single-round translocation. 22,49 Because the 2 parallel pathways (Pi release first, then translocation, or translocation first, then Pi release) eventually merge, further reactions on the translocation pathway, including EF-G dissociation, are blocked. 49,50 In the subsequent step, the tRNA, which has been displaced from the P to the E site, moves further through the ribosome via at least one distinct intermediate state (CHI5), and finally The swiveling motions of the SSU head are depicted by a color gradient from light green (classical non-swiveled SSU head position) to forest green (maximum degree of swiveling relative to the SSU body).…”