eDNA testing reveals surprising findings on fish population dynamics in Thailand

Osathanunkul, Maslin; Suwannapoom, Chatmongkon

doi:10.1016/j.heliyon.2023.e17102

Cited by 6 publications

(2 citation statements)

References 68 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Extracted DNA was used as a template for qPCR assay. Species‐specific primers and probe amplify a 109 bp targeting the mitochondrial cytochrome C oxidase subunit I gene (COI) for the G. cambodgiensis were used in the qPCR assays (Osathanunkul & Suwannapoom, 2023a ). Sequences of the primers and probe are (Forward primer) GarraCamCOI‐F250: 5′‐GGGTTTGGAAACTGGCTC‐3′, (Reverse primer) GarraCamCOI‐R337: 5′‐ATAATAGCAGGAATGATGGTGG‐3′ and (Probe) GarraCamCOI‐P287: FAM 5′‐CCCCCGACATGGCATTTC‐3′ MGB.…”

Section: Methodsmentioning

confidence: 99%

“…Environmental DNA has become a powerful method for monitoring aquatic biodiversity. Numerous studies have demonstrated its effectiveness in detecting fish species in Thai lotic and lentic water (Blackman et al., 2021 ; Osathanunkul, 2022 ; Osathanunkul & Minamoto, 2021a ; Osathanunkul & Suwannapoom, 2023a , 2023b ; Rodpai et al., 2023 ). The objective of this study was to develop an eDNA‐based survey to monitor the G. cambodgiensis in the Mekong River, which is the largest River Basin in Thailand and a highly profitable river fishery globally.…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

An eDNA‐based assessment of Garra cambodgiensis (stonelapping minnow) distribution on a megadiverse river, the Mekong

Osathanunkul,

Suwannapoom

2024

Ecology and Evolution

Self Cite

View full text Add to dashboard Cite

Garra cambodgiensis (stonelapping minnow) has experienced significant population declines, prompting intensive research and management, although its distribution in river systems such as the Mekong remains obscure. Effective conservation and management necessitate accurate monitoring and survey data on the distribution of freshwater species. Traditional surveying techniques for fish may be challenging and generate insufficient data on species distribution. This study developed an eDNA‐based method for detecting G. cambodgiensis to address this void. Twenty‐one locations were surveyed. Water samples were collected in triplicate from the river's surface at each site and processed within 48 h in a dedicated laboratory. Primers and probes for G. cambodgiensis were meticulously designed and species‐specificity tested to ensure accurate detection without interference from co‐occurring species in the same geographic range. Each water sample was analysed by qPCR using six technical replicates. The results of qPCR were reported as positive with quantifiable eDNA concentration (copies/mL), below the limit of quantification, or non‐detectable. G. cambodgiensis eDNA was detected in water samples collected from 10 out of 21 sampling sites, with concentrations ranging from 8.5 to 2990.0 copies/mL. Importantly, G. cambodgiensis eDNA was consistently detected in all three replicate water samples at each site where the qPCR experiment yielded positive results. The findings of this study demonstrate the feasibility and effectiveness of incorporating eDNA‐based monitoring or surveys for G. cambodgiensis in the ecologically diverse Mekong River. Monitoring based on eDNA can aid in targeting and informing conservation and management of G. cambodgiensis in its natural habitat. Comprehensive and robust information on species distribution can be obtained via an eDNA‐based survey, which could contribute to more efficient and informed decision‐making processes in fisheries management and conservation efforts.

show abstract

Section: Methodsmentioning

confidence: 99%