Dysregulation of spliceosome gene expression in advanced prostate cancer by RNA-binding protein PSF

Takayama, Ken Ichi; Suzuki, Takashi; Fujimura, Tetsuya; Yamada, Yuta; Takahashi, Satoru; Homma, Yukio; Suzuki, Yutaka; Inoue, Satoshi

doi:10.1073/pnas.1706076114

Cited by 90 publications

(123 citation statements)

References 39 publications

Supporting

Mentioning

118

Contrasting

Order By: Relevance

“…By using CLIP‐seq data, we found that Sfpq/Psf interacts with the App transcript at intronic regions, mainly intron 1 (Figure a). In line with this result, using RIP‐seq analysis of PSF in human prostate cancer cells (Takayama et al, ), we also found that APP transcripts interact with PSF at the RNA level. The ChIP‐seq data of RNA polII in mouse neuronal Neuro2a cells treated with siControl or siSfpq/Psf showed no obvious change in the distribution of polII binding after Sfpq/Psf silencing (Figure b), suggesting that App may not be regulated at transcription level.…”

Section: Resultssupporting

confidence: 86%

“…ChIP and quantitative PCR (qPCR) were conducted as previously described (Takayama et al, , ). The fold enrichment relative to input was measured by performing qPCR using the KAPA SYBR Green PCR Master Mix (Sigma Genosys) and Applied Biosystems StepOne.…”

Section: Methodsmentioning

confidence: 99%

“…We have reported that PSF/SFPQ, an RNA‐binding protein, is implicated in AR signaling because of its ability to splice RNA and consequently regulate epigenetic conditions (Takayama et al, ). In the present study, we explored the regulatory mechanisms of APP expression associated with AR and PSF using SH‐SY5Y cells derived from the human neurons (Butler, Leigh, & Gallo, ; Matsumoto et al, ), which express endogenous AR and exhibit androgen‐dependent cell growth (Sun et al, ).…”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Amyloid precursor protein, an androgen‐regulated gene, is targeted by RNA‐binding protein PSF/SFPQ in neuronal cells

2019

Self Cite

View full text Add to dashboard Cite

Amyloid precursor protein (APP) is a representative gene related to Alzheimer's disease (AD). Androgens function by binding to the androgen receptor (AR). Both androgen and RNA‐binding protein PSF play a role in the pathology of AD. However, the involvement of AR and PSF in APP regulation in neuron has not been investigated. Here, we explored the regulatory mechanism of APP expression by AR and PSF using neuron‐derived cells. We demonstrated that androgen up‐regulates the production of APP at the mRNA and protein levels. This induction is enhanced by AR over‐expression and inhibited by its silencing. One candidate AR‐binding region was identified in the intron region of APP and validated its activity as AR‐dependent enhancer by the luciferase assay. Furthermore, the public transcriptome data of brain tissues of mice indicated that APP is regulated by PSF post‐transcriptionally. We observed a decreased expression of APP after PSF knockdown and interaction of PSF with the APP transcript. Moreover, we revealed that silencing of PSF inhibited the stability of the APP mRNA. Thus, these results presented a new regulatory mechanism of APP expression by androgen through AR‐mediated transcription and PSF at the post‐transcriptional level that might be associated with the occurrence of AD.

show abstract

Section: Resultssupporting

confidence: 86%

Section: Methodsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Amyloid precursor protein, an androgen‐regulated gene, is targeted by RNA‐binding protein PSF/SFPQ in neuronal cells

2019

Self Cite

View full text Add to dashboard Cite

show abstract

“…The generated cDNA was subjected to real‐time PCR using an Applied Biosystems Step one plus real‐time PCR system based on SYBR Greenfluorescence (NIPPON Genetics, Tokyo, Japan). mRNA expression levels were normalized by GAPDH, and qRT‐PCR was undertaken as previously described . The following PCR primer sequences were used for qRT‐PCR: GAPDH forward, 5′‐ GGTGGTCTCCTCTGACTTCAACA; GAPDH reverse, 5′‐ GTGGTCGTTGAGGGCAATG; TRIM36 forward, 5′‐ AGTTCTGGAAGAGAGGAAATC‐3′; TRIM36 reverse, 5′‐ TCCATTTGAGTCTGAAATTG‐3′; BAX forward, 5′‐GTCGCCCTTTTCTACTTTGC‐3′; BAX reverse, 5′‐CTCAGCCCATCTTCTTCCAG‐3′; TNFSF10 forward, 5′‐AGACCTGCGTGCTGATGATCGTG‐3′; and TNFSF10 reverse, 5′‐CAAGCAATGCCACTTTTGCA‐3′.…”

Section: Methodsmentioning

confidence: 99%

Androgen‐responsive tripartite motif 36 enhances tumor‐suppressive effect by regulating apoptosis‐related pathway in prostate cancer

et al. 2018

Self Cite

View full text Add to dashboard Cite

Tripartite motif 36 (TRIM36) belongs to the TRIM family, most members of which are involved in ubiquitination and degradation of target proteins by functioning as E3 ubiquitin ligases. The function of TRIM36 has not been well documented, therefore, we investigated the clinical significance and function of TRIM36 in human prostate cancer (PC). Multivariate logistic regression analysis showed that TRIM36 immunoreactivity was an independent predictor of cancer‐specific survival of PC patients. Gain‐of‐function study revealed that overexpression of TRIM36 suppressed cell proliferation and migration of LNCaP, 22Rv1, and DU145 cells. Moreover, TRIM36 knockdown using siRNA suppressed apoptosis and promoted cell proliferation and migration in LNCaP and 22Rv1 cells. Furthermore, our microarray analysis revealed that the apoptosis‐related pathway was significantly upregulated by TRIM36 overexpression. The TUNEL assay showed that apoptosis promoted by docetaxel treatment was alleviated in siTRIM36‐treated LNCaP and 22Rv1 cells. Taken together, these results suggest that high expression of TRIM36 is associated with favorable prognosis and that TRIM36 plays a tumor‐suppressive role by inhibiting cell proliferation and migration as well as promoting apoptosis in PC.

show abstract

“…Recently, dysregulation of CHERP expression has been implicated in several cancers. For example, elevated expression of CHERP was observed in neuroblastoma and castration‐resistant prostate cancer . These studies provided evidence that CHERP plays an important role in promoting tumor growth.…”

Section: Introductionmentioning

confidence: 99%

U2‐related proteins CHERP and SR140 contribute to colorectal tumorigenesis via alternative splicing regulation

Wang

Liu

et al. 2019

Intl Journal of Cancer

View full text Add to dashboard Cite

Dysregulation of calcium homeostasis endoplasmic reticulum protein (CHERP) has been implicated in several cancers, but it remains elusive how CHERP contributes to cancer cell proliferation and cancer development. Here, we observed that CHERP and its binding partner SR140 are significantly upregulated in human clinical colorectal cancer tissues (CRC). CHERP and SR140 could form a protein complex to stabilize each other. Knockdown of CHERP or SR140 triggers double‐stranded DNA breaks and cell death. Furthermore, UPF3A, the RNA surveillance factor, was identified as a splicing target of CHERP and SR140, which bind specifically to the regulated exon4 and modulate UPF3A splicing. UPF3A knockdown recapitulates CHERP/SR140 depletion both in vitro and in mice. Importantly, overexpression of UPF3A significantly rescues proliferation defect of CHERP/SR140‐depleted cells. These results confirmed that the effect of CHERP/SR140 in promoting tumorigenesis was partially mediated by UPF3A. Extending these results, upregulation of CHERP/SR140 observed in CRC remarkably parallels increased inclusion of UPF3A exon4. Together, our study clarifies how CHERP/SR140 exert an oncogenic role in CRC development partially through regulating expression of UPF3A variants.

show abstract

Dysregulation of spliceosome gene expression in advanced prostate cancer by RNA-binding protein PSF

Cited by 90 publications

References 39 publications

Amyloid precursor protein, an androgen‐regulated gene, is targeted by RNA‐binding protein PSF/SFPQ in neuronal cells

Amyloid precursor protein, an androgen‐regulated gene, is targeted by RNA‐binding protein PSF/SFPQ in neuronal cells

Androgen‐responsive tripartite motif 36 enhances tumor‐suppressive effect by regulating apoptosis‐related pathway in prostate cancer

U2‐related proteins CHERP and SR140 contribute to colorectal tumorigenesis via alternative splicing regulation

Contact Info

Product

Resources

About