Dysregulation of In Vitro Decidualization of Human Endometrial Stromal Cells by Insulin via Transcriptional Inhibition of Forkhead Box Protein O1

Ujvári, Dorina; Jakson, Ivika; Babayeva, Shabnam; Salamon, Dániel; Réthi, Bence; Gidlöf, Sebastian; Hirschberg, Angelica Lindén

doi:10.1371/journal.pone.0171004

Cited by 38 publications

(32 citation statements)

References 69 publications

(67 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Thus, we speculated whether the antideciduogenic effect of C-peptide was regulated by the same pathway as that of insulin. Insulin inhibits decidualization by decreasing the expression of IGFBP1, but not PRL, in a FOXO1-dependent manner (Ujvari et al, 2017). As shown in Figure 3A, treatment with insulin reduced the mRNA expression of IGFBP1, as previously reported (Ujvari et al, 2017).…”

Section: C-peptide Potentiates the Inhibitory Effect Of Either Insulisupporting

confidence: 83%

C-Peptide Inhibits Decidualization in Human Endometrial Stromal Cells via GSK3β-PP1

Khaliq

Baek

Cho

et al. 2020

Front. Cell Dev. Biol.

View full text Add to dashboard Cite

Decidualization refers to the functional differentiation of endometrial stromal cells and plays a significant role in embryo implantation and pregnancy. C-peptide is excreted in equimolar concentrations as that of insulin during the metabolism of proinsulin in pancreatic beta-cells. High levels of C-peptide are correlated with hyperinsulinemia and polycystic ovarian syndrome, which show a defect in decidualization. However, the role of C-peptide in decidualization has not yet been studied. Here, we identified C-peptide as an endogenous antideciduogenic factor. This inhibitory function was confirmed by the reduced expression of decidual markers, including prolactin, insulin-like growth factor-binding protein-1, and Forkhead box protein O1 as well as by the fibroblastic morphological change in the presence of C-peptide. C-peptide also enhanced cellular senescence and decreased the proportion of apoptotic cells during decidualization. In addition, C-peptide potentiated the inhibitory effects of both insulin and palmitic acid in an AKT- and autophagy-independent manner, respectively. Furthermore, C-peptide augmented protein phosphatase 1 (PP1) activity, leading to a reduction in the inhibitory phosphorylation of glycogen synthase kinase (GSK)3β, which resulted in enhanced cellular senescence and decreased apoptosis during decidualization. Taken together, our findings suggest that C-peptide is an antideciduogenic factor acting via the regulation between PP1 and GSK3β in patients with hyperinsulinemia.

show abstract

Section: C-peptide Potentiates the Inhibitory Effect Of Either Insulisupporting

confidence: 83%

C-Peptide Inhibits Decidualization in Human Endometrial Stromal Cells via GSK3β-PP1

Khaliq

Baek

Cho

et al. 2020

Front. Cell Dev. Biol.

View full text Add to dashboard Cite

show abstract

“…Quantitative PCR (qPCR) was performed with the hTERT primer pair, FW: 5′GCCGTACATGCGACAGTTC3′ REV: 5′TCATTCAGGGAGGAGCTCTG3′ using Power SYBR® Green PCR Master Mix (Thermo Fisher Scientific) on a StepOnePlus™ Real-Time PCR System (Thermo Fisher Scientific) as per the manufacturer’s instructions. Ribosomal protein L13a RPL13A was used as a housekeeping gene FW: 5′CCTGGAGGAGAAGAGGAAAGAGA3′ REV: 5′TTGAGGACCTCTGTGTATTTGTCAA3′ [31].…”

Section: Methodsmentioning

confidence: 99%

Endometrial stromal cells exhibit a distinct phenotypic and immunomodulatory profile

et al. 2020

View full text Add to dashboard Cite

BackgroundIn Asherman’s syndrome (AS), intrauterine scarring and fibrotic adhesions lead to menstrual disorders, pregnancy loss, or infertility. A few clinical trials have piloted cell therapy to overcome AS. Understanding the role of the stromal compartment in endometrial regeneration remains poorly understood. We hypothesize that endometrial stromal cells (eSCs) represent a relevant cell population to establish novel cell-based therapeutics for endometrial disorders. The aim of this study was to characterize eSCs and evaluate their immune-cell interactions.MethodseSCs were isolated from healthy donors, during the proliferative stage of the menstrual cycle. Cells were characterized for expression of mesenchymal stromal cell (MSC) markers and assessed for their tumorigenic potential. eSCs were co-cultured with interferon γ and tumor necrosis factor α, and cell surface expression of their respective receptors and human leukocyte antigen (HLA) I and II determined by flow cytometry. Secreted levels of key immunomodulatory factors were established. eSCs were cultured with activated peripheral blood mononuclear cells, and T cell differentiation and proliferation determined.ResultseSCs demonstrated an MSC surface phenotype and exhibited multipotency. Expanded eSCs retained chromosomal stability and demonstrated no tumorigenicity. Upon stimulation, eSCs licensed to an anti-inflammatory phenotype with upregulated secretion of immunomodulatory factors. Stimulated eSCs did not express HLA class II. eSCs suppressed the proliferation and activation of CD4+ T cells, with the eSC secretome further downregulating central memory T cells and upregulating effector memory (EM) cells.ConclusionsDifferential responsiveness to inflammation by eSCs, compared to other MSC sources, demonstrates the need to understand the specific functional effects of individual stromal cell sources. A lack of HLA class II and triggering of EM T cell differentiation strongly links to innate in vivo roles of eSCs in tissue repair and immune tolerance during pregnancy. We conclude that eSCs may be an ideal cell therapy candidate for endometrial disorders.

show abstract

“…Intracellular levels of cyclic adenosine monophosphate (cAMP) reportedly increase during decidualization after several days of progestin treatment . It is well documented that the ovarian hormones, as well as relaxin, corticotropin‐releasing factor, and prostaglandin E2, induce the accumulation of intracellular cAMP . In human cell culture systems, cAMP is known as an inducer of decidualization and is associated with the expression of PRL and IGFBP‐1 as decidual markers.…”

Section: Regulation Of and Molecular Mechanisms During Decidualizationmentioning

confidence: 99%

“…A critical network for ESC decidualization is comprised of progesterone and proteins that are regulated by progesterone and/or cAMP. These include homeobox A10, forkhead box O1 (FOXO1), signal transducers and activators of transcription, as well as heart and neural crest derivatives expressed transcript 2 (HAND2), which is a transcription factor that is required for the development and growth of the branchial arches, limb buds, and heart. Furthermore, recent reports have described that HAND2 plays an important role in uterine receptivity .…”

Section: Regulation Of and Molecular Mechanisms During Decidualizationmentioning

confidence: 99%

“…29 It is well documented that the ovarian hormones, as well as relaxin, corticotropin-releasing factor, and prostaglandin E2, induce the accumulation of intracellular cAMP. 30,31 In human cell culture systems, cAMP is known as an inducer of decidualization and is associated with the expression of PRL and IGFBP-1 as decidual markers. The decidualization of the ESCs can be stimulated in vitro within a short time frame of ≤3 days by cAMP activation of the protein kinase Adependent pathway.…”

Section: Regulation Of and Molecular Mechanisms During Decidualizmentioning

confidence: 99%

See 1 more Smart Citation

Decidualization of the human endometrium

Okada

Tsuzuki

Murata

2018

Reprod Medicine & Biology

250

176

View full text Add to dashboard Cite

BackgroundDecidualization of the human endometrium, which involves a dramatic morphological and functional differentiation of human endometrial stromal cells (ESCs), is essential for the establishment of a successful pregnancy. Decidualization results from a complex interplay of transcription factors, morphogens, cytokines, cell cycle regulators, and signaling pathways.MethodsBased on a literature review, the regulation of, and the molecular mechanisms involved in, the decidualization of the endometrium are described.Main findingsProgesterone, together with proteins that are regulated by progesterone and/or cyclic adenosine monophosphate, including homeobox A10, forkhead box O1, signal transducers and activators of transcription, and heart and neural crest derivatives expressed transcript 2, forms a critical network for ESC decidualization and is a prerequisite to successful implantation. Decidualized ESCs contribute to the microenvironment at the feto–maternal interface and its direct or indirect influence on extracellular matrix remodeling, regulation of the local immune response, anti‐oxidative stress, and angiogenesis (vascular maturation). Impairment of this process is associated with a variety of pregnancy disorders, including infertility, recurrent miscarriages, and uteroplacental disorders.ConclusionA deeper understanding of the process of decidualization is expected to provide new insights into the fields of reproductive biology and reproductive medicine.

show abstract

Dysregulation of In Vitro Decidualization of Human Endometrial Stromal Cells by Insulin via Transcriptional Inhibition of Forkhead Box Protein O1

Cited by 38 publications

References 69 publications

C-Peptide Inhibits Decidualization in Human Endometrial Stromal Cells via GSK3β-PP1

C-Peptide Inhibits Decidualization in Human Endometrial Stromal Cells via GSK3β-PP1

Endometrial stromal cells exhibit a distinct phenotypic and immunomodulatory profile

Decidualization of the human endometrium

Contact Info

Product

Resources

About