Dyskerin Ablation in Mouse Liver Inhibits rRNA Processing and Cell Division

Ge, Jingping; Rudnick, David A.; He, Jun; Crimmins, Dan L.; Ladenson, Jack H.; Mason, Philip J.

doi:10.1128/mcb.01128-09

Cited by 39 publications

(42 citation statements)

References 58 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…[17][18][19] Nevertheless, recent studies have shed light on new molecular functions of snoRNAs and have demonstrated new expression patterns that could be associated with pathologic features. [20][21][22][23][24][25][26][27][28] In the present study, we demonstrate using high-throughput quantitative PCR methods that snoRNA expression analysis is helpful in the context of PTCL, both in terms of diagnosis and prognostication in patients treated with conventional chemotherapy.…”

Section: Introductionmentioning

confidence: 70%

Small nucleolar RNA expression profiling identifies potential prognostic markers in peripheral T-cell lymphoma

Valleron

Ysebaert

Berquet

et al. 2012

Blood

View full text Add to dashboard Cite

Peripheral T-cell lymphoma (PTCL) is a rare, heterogeneous type of non-Hodgkin lymphoma (NHL) that, in general, is associated with a poor clinical outcome. Therefore, a current major challenge is the discovery of new prognostic tools for this disease. In the present study, a cohort of 122 patients with PTCL was collected from a multicentric T-cell lymphoma consortium (TENOMIC). We analyzed the expression of 80 small nucleolar RNAs (snoRNAs) using high-throughput quantitative PCR. We demonstrate that snoRNA expression analysis may be useful in both the diagnosis of some subtypes of PTCL and the prognostication of both PTCL-not otherwise specified (PTCL-NOS; n ‫؍‬ 26) and angio-immunoblastic T-cell lymphoma (AITL; n ‫؍‬ 46) patients treated with chemotherapy. Like miRNAs, snoRNAs are globally down-regulated in tumor cells compared with their normal counterparts. In the present study, the snoRNA signature was robust enough to differentiate anaplastic large cell lymphoma (n ‫؍‬ 32) from other PTCLs. For PTCL-NOS and AITL, we obtained 2 distinct prognostic signatures with a reduced set of 3 genes. Of particular interest was the prognostic value of HBII-239 snoRNA, which was significantly overexpressed in cases of AITL and PTCL-NOS that had favorable outcomes. Our results suggest that snoRNA expression profiles may have a diagnostic and prognostic significance for PTCL, offering new tools for patient care and follow-up. (Blood. 2012;120(19):3997-4005)

show abstract

Section: Introductionmentioning

confidence: 70%

Small nucleolar RNA expression profiling identifies potential prognostic markers in peripheral T-cell lymphoma

Valleron

Ysebaert

Berquet

et al. 2012

Blood

View full text Add to dashboard Cite

show abstract

“…Autoradiography was performed using a phosphorscreen, and signals were acquired using a Typhoon Trio phosphorimager and analyzed with ImageQuant TL software (all GE Healthcare). Probe sequences were individually adopted from previous studies: ITS-1-mus (GCTCCTCCACAGTCTCCCGTTAATGATC) (55) and ITS-2-mus (ACCCACCGCAGCGGGTGACGCGATTGATCG) (57).…”

Section: Methodsmentioning

confidence: 99%

Suboptimal T-cell receptor signaling compromises protein translation, ribosome biogenesis, and proliferation of mouse CD8 T cells

Tan

Knight

Sbarrato

et al. 2017

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

Global transcriptomic and proteomic analyses of T cells have been rich sources of unbiased data for understanding T-cell activation. Lack of full concordance of these datasets has illustrated that important facets of T-cell activation are controlled at the level of translation. We undertook translatome analysis of CD8 T-cell activation, combining polysome profiling and microarray analysis. We revealed that altering T-cell receptor stimulation influenced recruitment of mRNAs to heavy polysomes and translation of subsets of genes. A major pathway that was compromised, when TCR signaling was suboptimal, was linked to ribosome biogenesis, a rate-limiting factor in both cell growth and proliferation. Defective TCR signaling affected transcription and processing of ribosomal RNA precursors, as well as the translation of specific ribosomal proteins and translation factors. Mechanistically, IL-2 production was compromised in weakly stimulated T cells, affecting the abundance of Myc protein, a known regulator of ribosome biogenesis. Consequently, weakly activated T cells showed impaired production of ribosomes and a failure to maintain proliferative capacity after stimulation. We demonstrate that primary T cells respond to various environmental cues by regulating ribosome biogenesis and mRNA translation at multiple levels to sustain proliferation and differentiation.

show abstract

“…Probes were purified using G25 columns (GE Healthcare) then incubated on membranes overnight in Church Gilbert's at 55°C. Sequential dilutions of SSC solution were used to wash membranes and autoradiography developed using a phosphorscreen (GE Healthcare (Rouquette et al 2005;Ge et al 2010;Sloan et al 2013).…”

Section: Pre-rrna Northern Blottingmentioning

confidence: 99%

Cooling-induced SUMOylation of EXOSC10 down-regulates ribosome biogenesis

Knight

Bastide

Peretti

et al. 2016

RNA

View full text Add to dashboard Cite

The RNA exosome is essential for 3 ′ processing of functional RNA species and degradation of aberrant RNAs in eukaryotic cells. Recent reports have defined the substrates of the exosome catalytic domains and solved the multimeric structure of the exosome complex. However, regulation of exosome activity remains poorly characterized, especially in response to physiological stress. Following the observation that cooling of mammalian cells results in a reduction in 40S:60S ribosomal subunit ratio, we uncover regulation of the nuclear exosome as a result of reduced temperature. Using human cells and an in vivo model system allowing whole-body cooling, we observe reduced EXOSC10 (hRrp6, Pm/Scl-100) expression in the cold. In parallel, both models of cooling increase global SUMOylation, leading to the identification of specific conjugation of SUMO1 to EXOSC10, a process that is increased by cooling. Furthermore, we define the major SUMOylation sites in EXOSC10 by mutagenesis and show that overexpression of SUMO1 alone is sufficient to suppress EXOSC10 abundance. Reducing EXOSC10 expression by RNAi in human cells correlates with the 3 ′ preribosomal RNA processing defects seen in the cold as well as reducing the 40S:60S ratio, a previously uncharacterized consequence of EXOSC10 suppression. Together, this work illustrates that EXOSC10 can be modified by SUMOylation and identifies a physiological stress where this regulation is prevalent both in vitro and in vivo.

show abstract

Dyskerin Ablation in Mouse Liver Inhibits rRNA Processing and Cell Division

Cited by 39 publications

References 58 publications

Small nucleolar RNA expression profiling identifies potential prognostic markers in peripheral T-cell lymphoma

Small nucleolar RNA expression profiling identifies potential prognostic markers in peripheral T-cell lymphoma

Suboptimal T-cell receptor signaling compromises protein translation, ribosome biogenesis, and proliferation of mouse CD8 T cells

Cooling-induced SUMOylation of EXOSC10 down-regulates ribosome biogenesis

Contact Info

Product

Resources

About