Dynein pulling forces counteract lamin-mediated nuclear stability during nuclear envelope repair

Penfield, Lauren; Wysolmerski, Brian; Mauro, Michael; Farhadifar, Reza; Martinez, Michael A Q; Biggs, Ronald; Wu, Hai‐Yin; Broberg, Curtis; Needleman, Daniel; Bahmanyar, Shirin

doi:10.1091/mbc.e17-06-0374

Cited by 52 publications

(52 citation statements)

References 89 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Statistical significance was determined using either a two-tailed unpaired Student's t-test or Mann Whitney U-test. P , 0.05 was considered statistically significant (Penfield et al 2018). The figure legends specify when error bars represent the standard deviation (SD) or interquartile range (IQR).…”

Section: Discussionmentioning

confidence: 99%

Rapid Degradation ofCaenorhabditis elegansProteins at Single-Cell Resolution with a Synthetic Auxin

Martinez

Kinney

Medwig-Kinney

et al. 2020

G3 Genes|Genomes|Genetics

View full text Add to dashboard Cite

As developmental biologists in the age of genome editing, we now have access to an ever-increasing array of tools to manipulate endogenous gene expression. The auxin-inducible degradation system allows for spatial and temporal control of protein degradation via a hormone-inducible Arabidopsis F-box protein, transport inhibitor response 1 (TIR1). In the presence of auxin, TIR1 serves as a substrate-recognition component of the E3 ubiquitin ligase complex SKP1-CUL1-F-box (SCF), ubiquitinating auxin-inducible degron (AID)-tagged proteins for proteasomal degradation. Here, we optimize the Caenorhabditis elegans AID system by utilizing 1-naphthaleneacetic acid (NAA), an indole-free synthetic analog of the natural auxin indole-3-acetic acid (IAA). We take advantage of the photostability of NAA to demonstrate via quantitative high-resolution microscopy that rapid degradation of target proteins can be detected in single cells within 30 min of exposure. Additionally, we show that NAA works robustly in both standard growth media and physiological buffer. We also demonstrate that K-NAA, the water-soluble, potassium salt of NAA, can be combined with microfluidics for targeted protein degradation in C. elegans larvae. We provide insight into how the AID system functions in C. elegans by determining that TIR1 depends on C. elegansSKR-1/2, CUL-1, and RBX-1 to degrade target proteins. Finally, we present highly penetrant defects from NAA-mediated degradation of the FTZ-F1 nuclear hormone receptor, NHR-25, during C. elegans uterine-vulval development. Together, this work improves our use and understanding of the AID system for dissecting gene function at the single-cell level during C. elegans development.

show abstract

Section: Discussionmentioning

confidence: 99%

Rapid Degradation ofCaenorhabditis elegansProteins at Single-Cell Resolution with a Synthetic Auxin

Martinez

Kinney

Medwig-Kinney

et al. 2020

G3 Genes|Genomes|Genetics

View full text Add to dashboard Cite

show abstract

“…In cells with an intact nuclear lamina, membrane rupture occurs in response to large stresses, such as migration through small pores in dense extra-cellular matrix or confinement between glass coverslips (Denais et al, 2016;Raab et al, 2016;Halfmann et al, 2019). However, in cells where the nuclear lamina has been disrupted by lamina protein depletion or introduction of disease-associated mutations in the gene encoding lamins A and C, membrane rupture occurs in response to smaller forces, such as nuclear migration in vivo or growth on tissue culture plastic (De Vos et al, 2011;Vargas et al, 2012;Tamiello et al, 2013;Hatch and Hetzer, 2016;Penfield et al, 2018;Earle et al, 2019).…”

Section: Introductionmentioning

confidence: 99%

“…Several model systems have been developed to investigate the consequence of nuclear membrane rupture. Membrane ruptures from confined migration or mechanical disruption, such as laser wounding, tend to be large and last longer than ruptures induced by lamina disruption and growth on stiff surfaces (De Vos et al, 2011;Vargas et al, 2012;Tamiello et al, 2013;Denais et al, 2016;Raab et al, 2016;Penfield et al, 2018;Halfmann et al, 2019). In both cases, nuclear membrane ruptures are repaired and generally non-lethal (De Vos et al, 2011;Vargas et al, 2012;Denais et al, 2016;Raab et al, 2016).…”

Section: Introductionmentioning

confidence: 99%

“…Several proteins that accumulate on the chromatin during NE assembly (reviewed in (LaJoie and Ullman, 2017)) also accumulate on exposed chromatin at membrane rupture sites, including BAF (barrier to autointegration factor), lamin A, LEM-domain nuclear transmembrane proteins (NETs), and the ESCRT-III membrane remodeling complex (Denais et al, 2016;Raab et al, 2016;Penfield et al, 2018;Halfmann et al, 2019). During NE assembly, BAF cross-links the chromatin mass to promote formation of a single nucleus (Samwer et al, 2017) and recruits lamin A and LEM domain NETs (Haraguchi et al, 2001;Margalit et al, 2005;Haraguchi et al, 2008;Appen et al, 2019), which bring ER membrane to the decondensing chromatin.…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

BAF facilitates interphase nuclear membrane repair through recruitment of nuclear transmembrane proteins

Young

Gunn

Hatch

2020

Preprint

View full text Add to dashboard Cite

Nuclear membrane rupture during interphase occurs in a variety of cell contexts, both healthy and pathological. In the primary nucleus, membrane ruptures are rapidly repaired but the mechanisms are still unclear. Here we show that BAF, a nuclear envelope protein that shapes chromatin and recruits additional NE proteins in mitosis, also facilitates nuclear membrane repair in interphase, in part through recruitment of the nuclear membrane proteins emerin and LEMD2 to rupture sites. Using a cancer cell line depleted of lamin B1 to drive membrane rupture, we confirmed that GFP-BAF accumulates at rupture sites and found that BAF depletion increased the duration of nucleus integrity loss after rupture, with the largest effects being on longer ruptures. This phenotype could be rescued by WT BAF, but not by a mutant lacking the LEM-protein binding domain. Depletion of LEMD2 or emerin, but not lamin A/C, was sufficient to significantly increase the proportion of long ruptures, consistent with LEM-protein binding being a key function of BAF during membrane repair. Overall our results suggest a membrane repair model where BAF facilitates the repair of large membrane ruptures, in part by recruiting transmembrane nuclear envelope proteins, but where small ruptures are repaired by a BAF-independent mechanism.Construction of stable cell lines U2OS RFP-NLS cells were made by transfecting U2OS cells with 2xRFP-NLS, selecting with 0.5 mg/ml G418 and collecting the RFP+ population by FACS. U2OS RFP-NLS EGFP-BAF shLmnB1 cells were made by infecting U2OS RFP-NLS cells with lentiviruses containing pLKO.1 shRNA-LmnB1.71 or EGFP-BAF-IRES-Blast vectors, selecting with10 μg/ml blasticidin (InvivoGen) and 2 μg/ml puromycin (Sigma-Aldrich) and sorting for RFP/GFP double positive cells by FACS. PlasmidsAll plasmids encoding EGFP-BAF (EGFP-BAF_WT, EGFP-BAF_L58R, EGFP-BAF_G47E and EGFP-BAF_G25E) were a gift from the Gerlich lab (IMBA, Vienna, Austria) and described in (Samwer et al., 2017). The EGFP-BAF-IRES-Blast cassettes are expressed under the control of a crippled EF1α promoter. EGFP-IRES-Blast was generated by digesting EGFP-BAF_WT with XbaI and BamHI to remove EGFP-BAF inserting and EGFP-only was PCR'd and inserted via sequence-and ligation-independent cloning (SLiC). Lamin B shRNAs were expressed from the lentiviral plasmid pLKO.1 shRNA-LmnB1.71 puro (SHCLND-NM_005573, Sigma-Aldrich). The sequence of the lamin B1 shRNA is 5′ CCGGGCATGAGAATTGAGAGCCTTTCTCGAGAAAGGCTCTCAATTCTCATGCTTTTT-3′. 2xRFP-NLS (RFP-NLS) was described previously (Hatch et al., 2013) and made by recombination of a PCR of TagRFP (Evrogen) fused to a C-terminal NLS (PPKKKRKV) into the Gateway vector pDONOR20 and recombining into pcDNA-DEST53-mCherry to generate mCherry-TagRFP-NLS. siRNA transfection All siRNA transfections were performed using siLentFect (Bio-Rad) according to manufacturer's instructions. Custom siRNAs (Dharmacon) against human BAF (#1. 5′-AGUUUCUGGUGCUAAAGAAtt-3′, #2. 5′-CCCUCACUUUCAAUCCGUUuu-3′), lamin A/C (5′-GGUGGUGACGAUCUGGGCUuu-3′)(Harada et al., 2...

show abstract

“…The protoplasts were isolated from 3-to 4-week-old Arabidopsis (Col-0) grown at 22°C under 8h light/16h dark and transfected following the protocol of tape-Arabidopsis sandwich method 13 . After 14-18 h incubation in low-light conditions, protoplasts were imaged on a Nikon Ti microscope with using a 60X 1.4 NA plan Apo objective lens as described previously 14 . The images were analyzed with FIJI 15 .…”

Section: Bimolecular Fluorescence Complementation (Bifc) and Confocalmentioning

confidence: 99%

GIGANTEA recruits deubiquitylases, UBP12 and UBP13, to regulate accumulation of the ZTL photoreceptor complex

Lee

Feke

et al. 2019

Preprint

View full text Add to dashboard Cite

8 To remain synchronous with the environment, plants constantly survey daily light conditions 9 using an array of photoreceptors and adjust their circadian rhythms accordingly. ZEITLUPE 10 (ZTL), a blue light photoreceptor with E3 ubiquitin ligase activity, communicates end-of-day 11 light conditions to the circadian clock. To function properly, ZTL protein must accumulate but 12 not destabilize target clock transcription factors before dusk, while in the dark ZTL mediates 13 degradation of target proteins. It is not clear how ZTL can accumulate to high levels in the light 14 while its targets remain stable. Two deubiquitylating enzymes, UBIQUITIN-SPECIFIC 15 PROTEASE 12 and UBIQUITIN-SPECIFIC PROTEASE 13 (UBP12 and UBP13), which have 16 opposite genetic and biochemical functions to ZTL, were shown to associate with the ZTL 17 protein complex. Here we demonstrate that the ZTL light-dependent interacting partner, 18GIGANTEA (GI), recruits UBP12 and UBP13 to the ZTL photoreceptor complex. We show that 19 loss of UBP12 and UBP13 reduces ZTL and GI protein levels through a post-transcriptional 20 mechanism. Furthermore, the ZTL target protein TOC1 is unable to accumulate to normal levels 21 in ubp mutants, indicating that UBP12 and UBP13 are necessary to stabilize clock transcription 22 factors during the day. Our results demonstrate that the ZTL photoreceptor complex contains 23 both ubiquitin-conjugating and -deconjugating enzymes, and that these two opposing enzyme 24 types are necessary for the complex to properly regulate the circadian clock. This work also 25 shows that deubiquitylating enzymes are a core design element of circadian clocks that is 26 conserved from plants to animals. 27 28 Main 29 Circadian clocks in all organisms rely on photoreceptors to sense light and entrain the central 30 oscillator. The exact timing of the light-to-dark transition (dusk) is especially important for 31 plants, as this indicates the length of the day and provides seasonal timing information necessary 32 for the adjustment of plant developmental processes (Carre

show abstract

Dynein pulling forces counteract lamin-mediated nuclear stability during nuclear envelope repair

Cited by 52 publications

References 89 publications

Rapid Degradation ofCaenorhabditis elegansProteins at Single-Cell Resolution with a Synthetic Auxin

Rapid Degradation ofCaenorhabditis elegansProteins at Single-Cell Resolution with a Synthetic Auxin

BAF facilitates interphase nuclear membrane repair through recruitment of nuclear transmembrane proteins

GIGANTEA recruits deubiquitylases, UBP12 and UBP13, to regulate accumulation of the ZTL photoreceptor complex

Contact Info

Product

Resources

About