Dynamics and Function of Phospholipase D and Phosphatidic Acid During Phagocytosis

Abstract

Phospholipase D (PLD) produces phosphatidic acid (PA), an established intracellular signalling lipid that has been also implicated in vesicular trafficking, and as such, PLD could play multiple roles during phagocytosis. Using an RNA interference strategy, we show that endogenous PLD1 and PLD2 are necessary for efficient phagocytosis in murine macrophages, in line with results obtained with wild-type constructs and catalytically inactive PLD mutants which, respectively, enhance and inhibit phagocytosis. Furthermore, we found that PA is transiently produced at sites of phagosome formation. Macrophage PLD1 and PLD2 differ in their subcellular distributions. PLD1 is associated with cytoplasmic vesicles, identified as a late endosomal/lysosomal compartment, whereas PLD2 localizes at the plasma membrane. In living cells undergoing phagocytosis, PLD1 vesicles are recruited to nascent and internalized phagosomes, whereas PLD2 is only observed on nascent phagosomes. These results provide evidence that both PLD isoforms are required for phagosome formation, but only PLD1 seems to be implicated in later stages of phagocytosis occurring after phagosomal internalization. Phagocytosis is an essential process of the innate immune response, enabling immune cells, such as macrophages, to eliminate large extracellular particles, invasive pathogens, cellular debris and apoptotic cells, by internalizing them in membrane-bound vacuoles, the phagosomes [reviewed in (1,2)]. Binding of the particle to diverse cell-surface receptors triggers phagocytosis. Certain phagocytic receptors recognize particle ligands, for example mannose and phosphatidylserine residues, whereas opsonin receptors, like the Fc receptors and complement receptors bind, respectively, the constant domain of immunoglobulins and complement proteins that coat particles. Clustering of phagocytic receptors activates complex intracellular signalling networks that have been extensively studied in the case of the Fc receptor [reviewed by (3)], and this initiates the extension of pseudopods which engulf the particle. Following internalization, phagosomes mature into phagolysosomes where the ingested material is degraded or processed for antigen presentation.During phagosome formation, pseudopod extension around the particle is driven by transient localized actin polymerization (4,5). This surface expansion also requires focal exocytosis of endomembranes, as demonstrated by capacitance and spectroscopic measurements (6,7). Hence, phagosome formation, as well as maturation, involves membrane trafficking between multiple intracellular membrane compartments [reviewed by (2)]. Classical actors of the exocytotic process such as the SNARE complex proteins (8) and specific phospholipids (9,10) participate in these trafficking events, although details of how these elements are interlinked to ensure an efficient machinery for phagocytosis remain to be established.Phospholipase D (PLD) has been recently described as a critical factor for exocytosis in neurons (11) and endocrine cells ...

The Coffin–Lowry syndrome-associated protein RSK2 is implicated in calcium-regulated exocytosis through the regulation of PLD1

“…Rat RSK2 cDNA fragments encoding the 21-nt siRNA sequence CTGAAGAAGGCAGTATCAAAG (identical in rat and bovine) derived from the target transcript or the mutated cDNA fragment CTCTAGAAGGCAG-TATCAAAG, separated from their reverse 19-nt complement by a short spacer, were annealed and cloned in the BglII and HindIII sites in front of the H1 promoter of either the pEGFP-N2-RNAi plasmid or a modified pXGH5 plasmid encoding GH (pGHsuper) as described (13). PLD1 siRNA and PLD1 rescue plamids have been described (12). T147 mutants were obtained by sitedirected mutagenesis as described (37).…”

Phosphatidic Acid Is a Leukocyte Chemoattractant That Acts through S6 Kinase Signaling

“…It has been shown before that PA induces a large fusogenic effect in membranes of several cell systems (48,49). Vesicular trafficking and exocytosis are all increased after membrane fusion of PA in vivo (7). PA location within the cell should be crucial to the production of movement.…”

“…Phosphatidic acid (PA) is a pleiotropic lipid second messenger in yeast, plants, and mammalian cells. In the latter it has been shown that vesicular trafficking and exocytosis are increased through promotion of membrane fusion by PA in vivo (7). PA also causes the formation of transformed colonies in soft agar or tumors in xenografted nude mice of H-RasV12 oncogene-transfected fibroblasts (8).…”

Cell surface dynamics – how Rho GTPases orchestrate the interplay between the plasma membrane and the cortical cytoskeleton

“…The assembly of the phagocytic cup appears to be controlled indirectly by regulators of small GTPases, such as the Rac GAP ARHGAP25 (Csépányi-Kömi et al, 2012) and the Rho GEF VAV2 (Arora et al, 2008). Interestingly, during their establishment, both the macropinocytic and phagocytic cups require an expansion of their limiting membrane, and this happens by the exocytosis of specific cytoplasmic vesicles (Falcone et al, 2006;Corrotte et al, 2006).…”