Dynamic CCAAT/Enhancer Binding Protein–Associated Changes of DNA Methylation in the Angiotensinogen Gene

Abstract

A ngiotensinogen (AGT; serpin peptidase inhibitor, clade A, member 8) is a glycoprotein that is the primary substrate of the renin-angiotensin-aldosterone system (RAAS) and is, therefore, one of the most frequently studied proteins because of its contributions to hypertension. Given that AGT is the primary substrate controlling the rate-limiting step of the production of angiotensin peptides, a rise in AGT levels can lead to a parallel increase in the formation of the physiologically active enzyme angiotensin II and may ultimately result in multiple diseases, such as hypertension, cardiovascular disease, and kidney injury. 1-3The AGT gene is expressed in many human tissues, as determined by an analysis of cDNA sequences available on the Unigene website. The AGT gene is known to be highly expressed in the liver, heart, and brain, whereas weakly expressed in the adrenal gland (www.ncbi.nlm.nih.gov/ sites/entrez?db=unigene; Figure S1 in the online-only Data Supplement). The expression of AGT is under developmental and hormonal control in a cell type-specific manner. 4 It is generally approved that AGT expression is predominantly regulated at the transcriptional level. 5 Multiple cis-acting DNA regulatory elements and transcription factors are known to be important in the regulation of AGT. 4,[6][7][8][9] Among those transcription factors, CCAAT/enhancer binding protein (CEBP) has been shown to increase AGT promoter activity through binding to the promoter region 6 and is important for the regulation of AGT in response to interleukin 6 (IL6). 6,10 The CEBP family facilitates the binding of other transcription factors to shared sites and contributes to efficient chromatin remodeling at some of these sites. This feature of CEBP function indicates that it is a pioneering factor for the assembly of transcription factor complexes at these sites. 11Abstract-DNA methylation patterns are maintained in adult somatic cells. Recent findings, however, suggest that all methylation patterns are not preserved. We demonstrate that stimulatory signals can change the DNA methylation status at a CCAAT/enhancer binding protein (CEBP) binding site and a transcription start site and activate expression of the angiotensinogen gene (AGT). A CEBP binding site in the human AGT promoter was hypomethylated in tissues with high expression of AGT, but not in those with low expression. The transcriptional activity of AGT promoter sequences cloned into a reporter plasmid depended on DNA methylation. In cultured human cells, interleukin 6 stimulation caused DNA demethylation around a CEBP binding site and a transcription start site; demethylation was accompanied by increased CEBP-β recruitment and chromatin accessibility of the AGT promoter. DNA methylation activity decreased in the nucleus. Excess circulating aldosterone upregulated AGT expression and was accompanied by DNA hypomethylation around a CEBP binding site and a transcription start site in human visceral adipose tissue. High salt intake led to upregulation of Agt expression, DNA hypometh...

Coordinated Regulation of miR-155 and miR-146a Genes during Induction of Endotoxin Tolerance in Macrophages

“…It is involved in both transcriptional activation and suppression, and recent evidence has implicated C/EBPb in the transcriptional silencing of miRNAs such as let-7i, miR-145, and miR-155 (53,63). Accessibility of promoters to C/EBPb depends on H3 methylation status at the C/EBPb binding region, as demonstrated previously (64,65). Indeed, H3 methylation was detected in the proximal region of the miR-155 and miR-146a promoters (Fig.…”

Epigenetic Regulation of Aldosterone Synthase Gene by Sodium and Angiotensin II

“…However, very little is known about where and how changes in DNA methylation take place in non‐CpG island promoters. We have recently shown that interleukin 6 stimulation can cause DNA demethylation of the angiotensinogen gene promoter in H295R cells 20. In our data, switching from a low‐salt diet for 4 weeks to a high‐salt diet for 4 weeks decreased aldosterone synthesis and induced hypermethylation of CYP11B2 in the adrenal glands.…”

“…We have recently shown that interleukin 6 stimulation can cause DNA demethylation of the angiotensinogen gene promoter in H295R cells. 20 In our data, switching from a low-salt diet for 4 weeks to a high-salt diet for 4 weeks decreased aldosterone synthesis and induced hypermethylation of CYP11B2 in the adrenal glands. Stimulatory signals will orchestrate local recruitment of transcription factors and global reduction in DNA methylation activity.…”

Angiotensinogen promoter methylation predicts bevacizumab treatment response of patients with recurrent glioblastoma

“…1). The sites were selected based on a previous study where DNA methylation of these cytosines, which are situated in a CEBP binding region, has been associated with both chromatin accessibility in human adrenocortical cells and with lower AGT expression in both humans and rats (Wang et al , 2014). Primers for PCR amplification [forward: 5′‐GGTGGTTGGTTTTAGGTTGTTATATA‐TTTA‐3′, reverse (biotinylated): 5′‐ACTATTCCCAAACTACCTATACAC‐3′] and sequencing (5′‐TGTTATATATTTA‐GGGAGATGT‐3′) were designed using the pyromark assay design 2.0 software (Qiagen).…”

“…The transcriptional activity of AGT has been found to be dependent on demethylation of the CEBP (CCAAT/enhancer‐binding protein) binding site of the AGT promoter region (Wang et al , 2014). Accordingly, the aim of this study was to investigate whether lower AGT promoter methylation in tumor tissue is predictive for glioblastoma patients not responding to bevacizumab combination therapy.…”