Dual Targeting of Topoisomerase IV and Gyrase To Reduce Mutant Selection: Direct Testing of the Paradigm by Using WCK-1734, a New Fluoroquinolone, and Ciprofloxacin

Abstract

Quinolones that act equally against DNA gyrase and topoisomerase IV are a desirable modality to decrease the selection of resistant strains. We first determined by genetic and biochemical studies in Staphylococcus aureus that the primary target enzyme of WCK-1734, a new quinolone, was DNA gyrase. A single mutation in gyrase, but not topoisomerase IV, caused a two-to fourfold increase in the MIC. Studies with purified topoisomerase IV and gyrase from S. aureus also showed that gyrase was more sensitive than topoisomerase IV to WCK-1734 (50% inhibitory concentration, 1.25 and 2.5 to 5.0 g/ml, respectively; 50% stimulation of cleavage complex formation, 0.62 and 2.5 to 5.0 g/ml, respectively). To test the effect of balanced activity of quinolones against the two target enzymes, we measured the frequency of selection of mutants with ciprofloxacin (which targets topoisomerase IV) and WCK-1734 alone and in combination. With the combination of ciprofloxacin and WCK-1734, each at its MIC, the ratio of frequency of mutants selected was significantly lower than that with each drug alone at two times their respective MICs. We further characterized resistant strains selected with the combination of ciprofloxacin and WCK-1734 and found evidence to suggest the existence of novel mutational mechanisms for low-level quinolone resistance. By use of a combination of differentially targeting quinolones, this study provides novel data in direct support of the paradigm for dual targeting of quinolone action and reduced development of resistance.Type II DNA topoisomerases, DNA gyrase and topoisomerase IV (TopoIV), are essential enzymes that regulate changes in DNA topology by catalyzing the concerted breakage and rejoining of DNA strands during normal cellular growth. They catalyze the relaxation of supercoiled DNA, catenation and decatenation of DNA rings, and knotting and unknotting of duplex DNA (37). DNA gyrase is unique in its ability to catalyze negative DNA supercoiling. Gyrase and TopoIV are heterotetramers of GyrA 2 GyrB 2 and ParC 2 ParE 2 , respectively. GyrA and ParC are the subunits responsible for DNA binding and the cleavage and religation reaction, and GyrB and ParE are responsible for ATP binding and hydrolysis (22).Quinolones act by forming ternary complexes with DNA and either DNA gyrase or TopoIV, thereby blocking DNA replication and triggering events leading to cell death (5, 12). Quinolone resistance occurs stepwise by mutations in the two topoisomerase target enzymes, with the first mutation generally occurring in the more sensitive enzyme (13). From the firststep mutants second-step double mutants can then be selected with resistance mutations in the second target enzyme, thereby conferring a high-level resistance phenotype (1,7,21). If the original sensitivities of both DNA gyrase and TopoIV were the same (i.e., dual targeting), no single mutational alteration in either enzyme would result in an increase in the MIC (11,25). Resistance would require, instead, concurrent alteration in both enzymes. Because spon...

Molecular Characterization of Fluoroquinolone Resistance of Methicillin –Resistant Clinical Staphylococcus aureus Isolates from Rawalpindi, Pakistan

“…In addition to the mutations in gyrase and topoisomerase genes, the contribution of efflux pumps that confer resistance to multiple antimicrobial agents in S. aureus has also been reported [6,18,24,27]. We observed the presence of efflux pump activity in all S. aureus isolates by an increased EtBr uptake and a reduction of antibiotic MICs in the presence of efflux pump inhibitors, CCCP and RES, as reported earlier [8,24,30]. A two to sixty four-fold reduction in FQ MICs after addition of the EPIs further confirmed the presence of active efflux pump activities in these isolates.…”

“…4). Of these five isolates, isolate10 had a novel point mutation (V371I) within the norA coding region and the other four isolates (30,32,35, and 41) had another novel point mutation (G291D). …”

DX-619, a Novel Des-Fluoro(6) Quinolone Manifesting Low Frequency of Selection of Resistant Staphylococcus aureus Mutants: Quinolone Resistance beyond Modification of Type II Topoisomerases

“…Chromosomal DNA from various mutants of S. aureus ISP794 was isolated using the Easy-DNA kit (Invitrogen, Carlsbad, CA) after lysing the cells with lysostaphin (Ambi, Lawrence, NY) at 0.1 mg/ml in phosphate-buffered saline and was used as a template for PCRs. The entirety of the parC, parE, gyrA, and gyrB structural genes and the promoter regions of parE, gyrB, and norA were individually amplified by PCR, as previously described (24,30). DNA sequencing of the PCR products was performed using the Taq DyeDeoxy Terminator method (Applied Biosystems) with the ABI 3700 PRISM automated sequencer (Massachusetts General Hospital core facility).…”

“…For the allelic exchange experiments, the following gene fragments were amplified with upstream and downstream primers containing engineered EcoRI and BamHI sites, respectively. For the gyrA mutation, the region between nucleotides 1746 and 2784 of the gyrB-gyrA tandem genes (GenBank accession number D10489) from mutant DX-619-C was amplified as previously described (30). For the parC mutants, the region between nucleotides 2019 and 2919 of the parE-parC tandem genes (GenBank accession number D67075) from mutants DX-619-JJ and DX-619-MM were amplified with the upstream (5ЈTTAGTAGAATTCTAAAGGCAAAACAAAGCGAGTTG) and downstream (5ЈAATTAAGGATCCGTGGTGGTATATCTGTCGCGC) primers containing engineered EcoRI and BamHI sites, respectively.…”

“…Quinolone resistance occurs stepwise by mutations in the two topoisomerase target enzymes, with the first mutation generally occurring in the more sensitive enzyme (11). Staphylococcus aureus mutants selected stepwise with quinolones usually first manifest a mutation in topo IV followed by a mutation in gyrase (18,25,30), or as has been recently reported for topo IV, mutation in the promoter region leading to reduced enzyme expression (16). In addition, several chromosomally encoded efflux pumps in S. aureus, including NorA (24, 34), NorB (32), and MepA (20), mediate low-level quinolone resistance when overexpressed.…”