Dual Role of Carcinoembryonic Antigen-Related Cell Adhesion Molecule 1 in Angiogenesis and Invasion of Human Urinary Bladder Cancer

Abstract

Here, we show that carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM1) is expressed in umbrella cells of bladder urothelium but is down-regulated in superficial bladder cancer, such as histologic tumor stage a (pTa) and transitional cell carcinoma in situ (pTis). Concurrently, CEACAM1 is up-regulated in the endothelia of adjacent angiogenic blood vessels. Mimicking the CEACAM1 down-regulation in the urothelium, CEACAM1 was silenced in bladder cancer cell lines 486p and RT4 using the small interfering RNA technique. CEACAM1 downregulation was confirmed at the protein level by Western blot analyses. CEACAM1 silencing leads to a significant up-regulation of vascular endothelial growth factor (VEGF)-C and VEGF-D in quantitative reverse transcription-PCR. Correspondingly, supernatants from the CEACAM1-overexpressing bladder cancer cell lines reduce, but those from CEACAM1 silencing induce endothelial tube formation and potentiate the morphogenetic effects of VEGF. These data suggest that the epithelial down-regulation of CEACAM1 induces angiogenesis via increased expression of VEGF-C and VEGF-D. Inversely, CEACAM1 is up-regulated in endothelial cells of angiogenic blood vessels. This in turn is involved in the switch from noninvasive and nonvascularized to invasive and vascularized bladder cancer. CEACAM1 appears to be a promising endothelial target for bladder cancer therapy.

CEA-related cell adhesion molecule-1 is involved in angiogenic switch in prostate cancer

“…In contrast, CEACAM1 gene silencing in these cells results in an upregulation of the mentioned factors and activates endothelial tube formation in vitro. The findings regarding the expression of VEGF-C and VEGF-D after CEACAM1 silencing in DU-145 cells are in line with our recently published data obtained from bladder cancer cell lines (Oliveira-Ferrer et al, 2004) but the data regarding VEGF-A and in particular regarding Ang1 and Ang2 are new findings in DU-145. This may reflect differences in the CEACAM1 signalling depending on cancer type.…”

“…The target regions for the siRNA sequences were selected from the cDNA of CEACAM1 according to the guidelines described by Elbashir et al (2002). The following targeted cDNA sequences for CEACAM1 silence and target sequence for firefly luciferase silence as negative control have recently been established in our lab (Oliveira-Ferrer et al, 2004): Targeted sequence (cDNA) TS152: 5 0 AACCTTCTGG AACCCGCCCAC, and targeted sequence (cDNA) TS210: 5 0 AATGTTGCAGAGGGGAAGGAG. Target sequence (cDNA): 5 0 AACGTACGCGGAATACTTCGA from the firefly luciferase gene was chosen as a control for CEACAM1 silencing studies.…”

CEACAM1 creates a pro-angiogenic tumor microenvironment that supports tumor vessel maturation

“…With regard to its function on tumor endothelia, vascular CEACAM1 expression has been related to angiogenically active tumor stages. However, studies systematically describing vascular CEACAM1 expression in the tumor periphery or on intratumoral vessels, or analyzing whether epithelial or vascular CEACAM1 expression would have any influence on the angiogenic properties of the tumor microenvironment, are lacking so far (Oliveira-Ferrer et al, 2004;Tilki et al, 2006;Dango et al, 2008). Recently, CEACAM1 has been identified as an important regulator of basal as well as acute vascular permeability.…”

The expression and modulation of CEACAM1 and tumor cell transformation

“…Oliveira-Ferrer and co-workers [54] have observed that cEAcAM1, which is ubiquitously expressed in the luminal surface of normal bladder urothelium, is down regulated in bladder cancer cells while it is concurrently up regulated in endothelial cells of adjacent blood vessels. This differential switch in cEAcAM1 expression is accompanied by an up-regulation of pro-angiogenic and pro-lymphangiogenic factors such as VEGF-c and -D. Interestingly, the orIgInAl ArtIcles And reVIews up-regulation of cEAcAM1 during this angiogenic activation of endothelial cells is detectable both in a membrane-bound form and in the supernatant of these cells [52].…”