Dual RNA-seq to catalogue host and parasite gene expression changes associated with virulence of T. annulata-transformed bovine leukocytes: towards identification of attenuation biomarkers

Abstract

The apicomplexan parasite Theileria annulata is transmitted by Hyalomma ticks and causes an acute lymphoproliferative disease that is invariably lethal in exotic cattle breeds. The unique ability of the schizont stage of T. annulata to transform infected leukocytes to a cancer-like phenotype and the simplicity of culturing and passaging T. annulata-transformed cells in vitro have been explored for live vaccine development by attenuating the transformed cells using lengthy serial propagation in vitro. The empirical in vivo evaluation of attenuation required for each batch of long-term cultured cells is a major constraint since it is resource intensive and raises ethical issues regarding animal welfare. As yet, the molecular mechanisms underlying attenuation are not well understood. Characteristic changes in gene expression brought about by attenuation are likely to aid in the identification of novel biomarkers for attenuation. We set out to undertake a comparative transcriptome analysis of attenuated (passage 296) and virulent (passage 26) bovine leukocytes infected with a Tunisian strain of T. annulata termed Beja. RNA-seq was used to analyse gene expression profiles and the relative expression levels of selected genes were verified by real-time quantitative PCR (RT-qPCR) analysis. Among the 3538 T. annulata genes analysed, 214 were significantly differentially expressed, of which 149 genes were up-regulated and 65 down-regulated. Functional annotation of differentially expressed T. annulata genes revealed four broad categories of metabolic pathways: carbon metabolism, oxidative phosphorylation, protein processing in the endoplasmic reticulum and biosynthesis of secondary metabolites. It is interesting to note that of the top 40 genes that showed altered expression, 13 were predicted to contain a signal peptide and/or at least one transmembrane domain, suggesting possible involvement in host-parasite interaction. Of the 16,514 bovine transcripts, 284 and 277 showed up-regulated and down-regulated expression, respectively. These were assigned to functional categories relevant to cell surface, tissue morphogenesis and regulation of cell adhesion, regulation of leucocyte, lymphocyte and cell activation. The genetic alterations acquired during attenuation that we have catalogued herein, as well as the accompanying in silico functional characterization, do not only improve understanding of the attenuation process, but can also be exploited by studies aimed at identifying attenuation biomarkers across different cell lines focusing on some host and parasite genes that have been highlighted in this study, such as bovine genes (CD69, ZNF618, LPAR3, and APOL3) and parasite genes such as TA03875.

A Theileria annulata parasite with a single mutation, methionine 128 to isoleucine (M128I), in cytochrome B is resistant to buparvaquone

“…Ta9 primers were forward: ; reverse: and Tamr1 primers forward: reverse: ). mRNA levels were normalized to Theileria actin II (TA13410) with the forward ( ) and reverse ) primers [ 47 ]. The 2 −ΔΔCT Method was used to calculate relative mRNA expression levels.…”

“…GCTCGTCTAATTAAACTCTTCT and Tamr1 primers forward: CCACTCCTGTAGCGGGT AAA; reverse: TTGTGGAGGTACTGACCCAAA). mRNA levels were normalized to Theileria actin II (TA13410) with the forward (GACATTAAGGAGCGGTGCTG) and reverse (AGTAGTG CCGTCTGGGAGTTT) primers [47]. The 2 −ΔΔCT Method was used to calculate relative mRNA expression levels.…”