Downstream sequence elements with different affinities for the hnRNP H/H' protein influence the processing efficiency of mammalian polyadenylation signals

Arhin, George K.; Boots, Monika; Bagga, Paramjeet S.; Milcarek, Christine; Wilusz, Jeffrey

doi:10.1093/nar/30.8.1842

Cited by 90 publications

(96 citation statements)

References 43 publications

(63 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…We propose that certain regulatory factor(s) highly expressed in ES cells specifically bind to G-rich and C/Urich sequences around the proximal poly(A) sites and stimulate polyadenylation at these sites. For example, hnRNP H and related proteins have been shown to regulate polyadenylation by binding to G-rich auxiliary elements (Arhin et al 2002). Differentiated cells may express lower levels of such regulatory factors and, as a result, canonical distal poly(A) sites are preferentially used as they are recognized by the cleavage/polyadenylation machinery with higher affinity.…”

Section: Discussionmentioning

confidence: 99%

Complex and dynamic landscape of RNA polyadenylation revealed by PAS-Seq

Shepard¹,

Choi²,

Lu³

et al. 2011

RNA

396

435

View full text Add to dashboard Cite

Alternative polyadenylation (APA) of mRNAs has emerged as an important mechanism for post-transcriptional gene regulation in higher eukaryotes. Although microarrays have recently been used to characterize APA globally, they have a number of serious limitations that prevents comprehensive and highly quantitative analysis. To better characterize APA and its regulation, we have developed a deep sequencing-based method called Poly(A) Site Sequencing (PAS-Seq) for quantitatively profiling RNA polyadenylation at the transcriptome level. PAS-Seq not only accurately and comprehensively identifies poly(A) junctions in mRNAs and noncoding RNAs, but also provides quantitative information on the relative abundance of polyadenylated RNAs. PAS-Seq analyses of human and mouse transcriptomes showed that 40%-50% of all expressed genes produce alternatively polyadenylated mRNAs. Furthermore, our study detected evolutionarily conserved polyadenylation of histone mRNAs and revealed novel features of mitochondrial RNA polyadenylation. Finally, PAS-Seq analyses of mouse embryonic stem (ES) cells, neural stem/progenitor (NSP) cells, and neurons not only identified more poly(A) sites than what was found in the entire mouse EST database, but also detected significant changes in the global APA profile that lead to lengthening of 39 untranslated regions (UTR) in many mRNAs during stem cell differentiation. Together, our PAS-Seq analyses revealed a complex landscape of RNA polyadenylation in mammalian cells and the dynamic regulation of APA during stem cell differentiation.

show abstract

Section: Discussionmentioning

confidence: 99%

Complex and dynamic landscape of RNA polyadenylation revealed by PAS-Seq

Shepard¹,

Choi²,

Lu³

et al. 2011

RNA

396

435

View full text Add to dashboard Cite

show abstract

“…These auxiliary elements are generally G-rich, but they lack a conserved sequence and distance from the cleavage site. In addition, more than one auxiliary sequences can be present in a gene [2,[60][61][62][63][64].…”

Section: The Downstream Element (Dse)-mentioning

confidence: 99%

Protein factors in pre-mRNA 3′-end processing

Mandel

Bai

Tong

2007

Cell. Mol. Life Sci.

355

482

View full text Add to dashboard Cite

Most eukaryotic mRNA precursors (pre-mRNAs) must undergo extensive processing, including cleavage and polyadenylation at the 3′-end. Processing at the 3′-end is controlled by sequence elements in the pre-mRNA (cis elements) as well as protein factors. Despite the seeming biochemical simplicity of the processing reactions, more than 14 proteins have been identified for the mammalian complex, and more than 20 proteins have been identified for the yeast complex. The 3′-end processing machinery also has important roles in transcription and splicing. The mammalian machinery contains several sub-complexes, including cleavage and polyadenylation specificity factor (CPSF), cleavage stimulation factor (CstF), cleavage factor I (CF I m ), and cleavage factor II (CF II m ). Additional protein factors include poly(A) polymerase (PAP), poly(A) binding protein (PABP), symplekin, and the C-terminal domain (CTD) of RNA polymerase II largest subunit. The yeast machinery includes cleavage factor IA (CF IA), cleavage factor IB (CF IB), and cleavage and polyadenylation factor (CPF).

show abstract

“…This site was taken from the polyadenylation signal in the HUMMK gene (Arhin et al 2002). The HUMMK DNA oligo (CCATGGTTTGGGAGTGGGAAGGTGGGGAG) is bound by recombinant hnRNP H but not A1 (Supplemental Fig.…”

Section: Fisette Et Almentioning

confidence: 99%

“…2A) and it is part of a polyadenylation signal in the RATCRP2A gene (Arhin et al 2002). Since GGG represents the core sequence found in many binding sites for hnRNP H (Caputi and Zahler 2001), but is also part of the high-affinity binding site for hnRNP A1 (Burd and Dreyfuss 1994), we first assessed if HBS3 was bound specifically by hnRNP H. Using a filter binding assay, we show that HBS3 is bound more efficiently by recombinant hnRNP H than by hnRNP A1 (Fig.…”

Section: Fisette Et Almentioning

confidence: 99%

hnRNP A1 and hnRNP H can collaborate to modulate 5′ splice site selection

Fisette¹,

Toutant²,

Dugré-Brisson³

et al. 2009

RNA

View full text Add to dashboard Cite

The mammalian proteins hnRNP A1 and hnRNP H control many splicing decisions in viral and cellular primary transcripts. To explain some of these activities, we have proposed that self-interactions between bound proteins create an RNA loop that represses internal splice sites while simultaneously activating the external sites that are brought in closer proximity. Here we show that a variety of hnRNP H binding sites can affect 59 splice site selection. The addition of two sets of hnRNP H sites in a model pre-mRNA modulates 59 splice site selection cooperatively, consistent with the looping model. Notably, binding sites for hnRNP A1 and H on the same pre-mRNA can similarly collaborate to modulate 59 splice site selection. The C-terminal portion of hnRNP H that contains the glycine-rich domains (GRD) is essential for splicing activity, and it can be functionally replaced by the GRD of hnRNP A1. Finally, we used the bioluminescence resonance energy transfer (BRET) technology to document the existence of homotypic and heterotypic interactions between hnRNP H and hnRNP A1 in live cells. Overall, our study suggests that interactions between different hnRNP proteins bound to distinct locations on a pre-mRNA can change its conformation to affect splicing decisions.

show abstract

Downstream sequence elements with different affinities for the hnRNP H/H' protein influence the processing efficiency of mammalian polyadenylation signals

Cited by 90 publications

References 43 publications

Complex and dynamic landscape of RNA polyadenylation revealed by PAS-Seq

Complex and dynamic landscape of RNA polyadenylation revealed by PAS-Seq

Protein factors in pre-mRNA 3′-end processing

hnRNP A1 and hnRNP H can collaborate to modulate 5′ splice site selection

Contact Info

Product

Resources

About