Downregulation of thrombospondin-1 by DNA hypermethylation is associated with tumor progression in laryngeal squamous cell carcinoma

Abstract

Thrombospondin-1 (THBS-1) has been demonstrated to have a complicated role in human cancer and to exert stimulatory and inhibitory effects in different types of tumors. DNA methylation, as the most frequent mechanism for gene silencing, has been widely investigated in regards to the development of tumors. However, the expression levels and methylation status of THBS-1, and their roles in laryngeal squamous cell carcinoma (LSCC) remain to be elucidated. The present study detected downregulated THBS-1 mRNA and protein expression levels in LSCC by using reverse transcription-quantitative polymerase chain reaction (PCR) and western blotting, while decreased expression levels of THBS-1 mRNA and protein were significantly associated with lymph node metastasis and tumor-node-metastasis (TNM) stage. Furthermore, aberrant methylation of THBS-1 was frequently observed in LSCC by methylation-specific PCR, particularly in tumor tissues from lymph node metastasis or samples from cancer with advanced TNM stage. Furthermore, the current study demonstrated that downregulated expression of THBS-1 in LSCC was consistent with aberrant methylation of this gene. Treatment with the DNA methyltransferase inhibitor 5-aza-2′-deoxy-cytidine in Hep-2 cells induced demethylation of THBS-1, enhanced THBS-1 expression, and inhibited the proliferative and invasive ability of Hep-2 cells. Collectively, the results of the present study suggest that THBS-1 may exert an inhibitory effect in the development of LSCC. Aberrant methylation was an important reason for the downregulation of THBS-1 and was involved in the invasion and metastasis of LSCC. Demethylating agents may be effective candidates for the treatment of LSCC.

Long non-coding RNA BZRAP1-AS1 silencing suppresses tumor angiogenesis in hepatocellular carcinoma by mediating THBS1 methylation

“…DNA methylation abnormalities are a common mark of human diseases involving chromosomal and genomic instabilities, such as inherited diseases and cancers [26]. Consistent with our results, inhibition of THBS1 induced by DNA hypermethylation shares an association with tumor progression in laryngeal squamous cell carcinoma [27]. LncRNA LUCAT1 affects the stability of DNMT1 and decreases the expression of tumor suppressor genes in a way of DNA methylation, thereby inducing tumorigenesis in esophageal squamous cell carcinoma [28].…”

Elevated DNA methylation in malignant tumors of the sinonasal tract and its association with patient survival

“…GATA5 methylation has been already found in hepatocellular carcinoma 22 , colorectal cancer 23 , glioblastomas 24 and ovarian cancer 25 . THBS1 methylation has been demonstrated in laryngeal squamous cell carcinoma 26 , glioblastomas 24 and ovarian cancer 25 and PAX5 methylation has been shown in Table 2. Clinicopathological characteristics and methylation.…”

Circulating methylated THBS1 DNAs as a novel marker for predicting peritoneal dissemination in gastric cancer

“…Bisulfite modification of genomic DNAs was performed by EZ DNA Methylation‐Gold™ Kit (Zymo Research, 625 West Katella Avenue, Suite 30 Orange, CA 92867–4619) following the operating manual's instructions. The specific primers for the methylation and non‐methylation of THBS1 gene were designed as reported previously 37 . The primer sequences of THBS1 methylation were as follows: forward: 5'‐TTGAGTACGTTAAGGTTGCGTGGGC‐3', reverse: 5'‐TA AAAACACTAAAACTACCAATACACCAAA‐3'; the size of the amplification product is 212 bp 37 .…”

“…The specific primers for the methylation and non‐methylation of THBS1 gene were designed as reported previously 37 . The primer sequences of THBS1 methylation were as follows: forward: 5'‐TTGAGTACGTTAAGGTTGCGTGGGC‐3', reverse: 5'‐TA AAAACACTAAAACTACCAATACACCAAA‐3'; the size of the amplification product is 212 bp 37 . The primer sequences of THBS1 unmethylation were as follows: forward: 5'‐GGTTGAGTATGTTAAGGTTGTGTGGGT‐3', reverse: 5'‐TAAAAACACTAAAACTACCAATACACCAAA‐3'; the size of amplification products is 230 bp 37 .…”

“…37 The primer sequences of THBS1 methylation were as follows: forward: 5'-TTGAGTACGTTAAGGTTGCGTGGGC-3', reverse: 5'-TA AAAACACTAAAACTACCAATACACCAAA-3'; the size of the amplification product is 212 bp. 37 The primer sequences of THBS1 unmethylation were as follows: forward: 5'-GGTTGAGTATGTTAAGG TTGTGTGGGT-3', reverse: 5'-TAAAAACACTAAAACTACCAATACA CCAAA-3'; the size of amplification products is 230 bp. 37 Modified DNA samples were analyzed by quantitative MSP on ABI7500 PCR (Applied Biosystems, 850 Lincoln Centre Drive, 94404) by SYBR Premix Taq ExTaq Kit (TaKaRa Bio Inc., .…”