Downregulation of miR-382 by propranolol inhibits the progression of infantile hemangioma via the PTEN-mediated AKT/mTOR pathway

Li, Dongfan; Li, Peng; Guo, Zhengtuan; Wang, Huaijie; Pan, Weikang

doi:10.3892/ijmm.2017.2863

Cited by 39 publications

(33 citation statements)

References 27 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Recently, miR-4295 is found to be a novel oncogenic miRNA in non-small cell lung cancer. 35 We hypothesized that miR-4295 might be involved in the progress of propranolol regulating IH. 34 Whereupon, we examined miR-4295 expression in IH tissues and adjacent tissues, and results showed that miR-4295 expression was significantly upregulated in IH tissues.…”

Section: Discussionmentioning

confidence: 99%

Retracted: Propranolol suppresses HUVEC viability, migration, VEGF expression, and promotes apoptosis by downregulation of miR‐4295

Zhao

Yang

et al. 2018

J of Cellular Biochemistry

View full text Add to dashboard Cite

Infantile hemangioma (IH) is a common benign tumor. Human umbilical vein endothelial cells (HUVECs) have the potential of stem cells, which has been widely used in vascular endothelial cell experiments. Oral propranolol was first reported to treat hemangioma in 2008. However, the role of propranolol in IH remains unclear. Therefore, in this study, we investigated the effects of propranolol on HUVECs in vitro, to explore the underlying mechanism of propranolol in IH. HUVECs were treated with 0.15, 1.5, and 15 μM of propranolol, and transfected with microRNA‐4295 (miR‐4295) mimic. Cell viability, migration, and apoptosis were examined using Cell Counting Kit‐8, transwell assay, and flow cytometry analysis, respectively. In addition, the expressions and concentrations of miR‐4295, vascular endothelial growth factor (VEGF), VEGF‐A, FLT1, FLT2, and FOXF1 were assessed using real‐time polymerase chain reaction, Western blot assay, and enzyme‐linked immunosorbent assay. We found that 15 μM of propranolol decreased HUVEC viability the most. Then, cell migration and the concentrations of VEGF and VEGF‐A were reduced, and apoptosis was increased when treated with propranolol. Meanwhile, the expressions of VEGF, VEGF‐A, FLT1, FLT2, and FOXF1 were downregulated by propranolol exposure. Further study showed that miR‐4295 expression was upregulated in IH tissues, and propranolol treatment downregulated miR‐4295 expression in HUVECs. MiR‐4295 overexpression alleviated the reductions of viability, migration, and factors expression, as well as the increase of apoptosis. Propranolol suppressed HUVEC viability, migration, the expression of VEGF, VEGF‐A, FLT1/2, FOXF1, and promoted apoptosis via downregulation of miR‐4295. This study lays a foundation for further study of the effect of propranolol on IH.

show abstract

Section: Discussionmentioning

confidence: 99%

Retracted: Propranolol suppresses HUVEC viability, migration, VEGF expression, and promotes apoptosis by downregulation of miR‐4295

Zhao

Yang

et al. 2018

J of Cellular Biochemistry

View full text Add to dashboard Cite

show abstract

“…A significantly higher angiostatin level was seen among HF patients using beta blocker therapy than in those who did not. There is some research in the literature about the effect of beta blockers on angiogenesis related to the effects of propranolol in infantile hemangioma and the anti-angiogenic effect of beta blockers in breast cancer patients [17,18]. According to our findings, we hypothesize that the use of beta blockers may reduce angiogenesis via increasing angiostatin in HF patients with CKD.…”

Section: Discussionsupporting

confidence: 58%

Angiostatin Levels in Systolic Heart Failure Patients with Chronic Kidney Disease

Ertürk¹

2019

Int J Med Biochem

View full text Add to dashboard Cite

Angiostatin levels in systolic heart failure patients with chronic kidney disease C KD is characterized by alterations in kidney function, which manifest in various ways, depending upon the underlying causes and the severity of the disease [1-3]. Heart failure (HF) with reduced ejection (HFrEF) occurs when the ejection fraction (EF) is less than 40%. When the EF is in the range of 40% to 50%, it is classified as HF with mid-range EF (HFmrEF). These conditions are considered systolic HF [4, 5]. Angiostatin is a naturally occurring protein, formed through the process of the fragmentation of plasminogen. It is a potent endogenous inhibitor of mesenchymal stem cells, endothelial cells, and angiogenesis [6]. Many studies have focused on the effect of angiostatin on endothelial cell apoptosis, though the mechanisms of action are still not yet completely understood [7, 8]. The binding of angiostatin to plasma membrane-localized adenosine triphosphate (ATP) synthase suppresses ATP metabolism in the endothelial cells, and thus downregulates en-dothelial cell proliferation [9]. Objectives: Heart failure (HF) with reduced ejection fraction (HFrEF) is defined as an ejection fraction (EF) of less than 40%. An EF of 40% to 50% is known as HF with mid-range EF, which is considered a subgroup of HF with preserved ejection fraction, rather than HFrEF. Angiostatin inhibits angiogenesis and the proliferation of mesenchymal stem cells. Though many studies in the literature have focused on the effect of angiostatin on endothelial cell apoptosis, studies about angiostatin levels in HF patients are limited. The aim of this study was to evaluate the angiostatin level in systolic HF patients with chronic kidney disease (CKD). Methods: A group of 69 individuals, consisting of patients with a diagnosis of systolic HF with CKD (n=29) and healthy (n=40) subjects, was included in the current study. Serum angiostatin, plasma N-terminal pro-brain type natriuretic peptide, and creatinine levels were assessed, and transthoracic echocardiography was performed. Results: The angiostatin level of the patient group was significantly higher than that of the control group (median: 163 ng/mL [25 th-75 th interquartile range: 48-336 ng/mL] and median: 58.14 ng/mL [25 th-75 th interquartile range: 18.1-167 ng/mL], respectively; p=0.02). The angiostatin level of HF patients receiving beta blocker therapy was significantly higher than that of the HF patients who were not taking a beta blocker (105.3 ng/mL [50.7-220.7 ng/mL] and 70.4 ng/ mL [35-224 ng/mL], respectively; p=0.02). Conclusion: To the best of our knowledge, this study is the first to examine this subject. Angiostatin may be an important marker in systolic HF patients with CKD. The use of a beta blocker may inhibit angiogenesis and induce apoptosis in HF patients with CKD. Further studies are required.

show abstract

“…The mature gene locus were chr14:101,054,316-101,054,337, and the base sequence was GAAGUUGUUCGUGGUGGAUUCG , with a length of 22 nt. (Fig.1) 2.1.2 hsa-miR-382-5P participates in disease regulation Using PubMed to retrieve the related literature of miR-382-5P, we found that miR-382-5P was upregulated in acute promyelocytic leukemia [7,8] , atherosclerosis [12] ,breast cancer [4] ,epidural fibrosis [10] , primary myelofibrosis [9] , primary liver cancer [11] ,cervical cancer [13] , but down-regulated in glioma [5,6] ,oral squamous cell carcinoma [3] ,miR-382 was down-regulated in non-small cell lung cancer [14,15] , osteosarcoma [16] , prostate cancer [19] ,ovarian cancer [20] , primary liver cancer [24] , colorectal cancer [21,22] , while schizophrenia [25] ,diabetic nephropathy [17] , IgA nephropathy [18] ,infantile hemangioma [23] . Thus, the expression of miR-382-5P is tissue-specific, and it is involved in the regulation of cell viability, migration, invasion, angiogenesis, proliferation, cell differentiation, oxidative stress and other biological behaviors.…”

Section: Data Analysis Of Tcga Databasementioning

confidence: 99%

“…A series of nucleases obtained mature miR-382-5P and miR-382-3P by cutting and editing miR-382, in which miR-382-5P was located in the long arm of chromosome 14. In recent years, many studies have shown that the expression of miR-382-5P is abnormal in oral squamous cell carcinoma [3] ,breast cancer [4] ,glioma [5,6] ,acute promyelocytic leukemia [7,8] ,primary myelofibrosis [9] ,epidural fibrosis [10] ,primary liver cancer [11] ,atherosclerosis [12] ,cervical cancer [13] ,miR-382 is abnormal in non-small cell lung cancer [14,15] , osteosarcoma [16] , diabetic nephropathy [17] , IgA nephropathy [18] prostate cancer [19] ,ovarian cacner [20] ,colorectal cancer [21,22] ,infantile hemangioma [23] ,primary liver cancer [24] ,schizophrenia [25] , which are closely related to the proliferation, differentiation, migration, invasion, drug resistance and other biological processes of tumor cells. However, the expression and clinical significance of miR-382-5P in ovarian cancer have not been reported.…”

Section: Introductionmentioning

confidence: 99%

Analysis of the expression and clinical significance of miR-382-5P in ovarian cancer based on biological information

2020

Preprint

View full text Add to dashboard Cite

Objective : To investigate the expression, potential function and clinical significance of miR-382-5P in ovarian cancer tissues . Results: The expression of miR-382-5P is tissue-specific. Four target gene prediction softwares including miRPathDB ,DIANA ,miRWalk and starBase simultaneously predicted 24 target genes (AHRR，ANKS1A，C15orf41，CABYR，CASP3，COBLL1，EEF2K，FBXO28，FGFR1OP，LRP12，MDM4，PAIP2，PARM1，PDE5A，PIAS2，SAR1B，SCD，SLC44A1，TIMM17A，TSPYL1，UBXN7， YES1，ZBTB37，ZNF587). Significant enrichment of target gene function in biological processes, cell composition and molecular functions, signal transduction pathways are significantly enriched in microRNAs in cancer , MAPK signaling pathway, Hepatitis B, FoxO signaling pathway, Non-small cell lung cancer, apoptosis, Colorectal cancer, Oxytocin signaling pathway. TCGA database data analysis did not indicate that there was a correlation between the expression of miR-382-5P and the clinicopathological parameters of ovarian cancer, but there was no significant difference (P>0.05). The results of QRT-PCR in 72 ovarian cancer clinical specimens showed that the expression of miR-382-5P was significantly increased in drug-resistant tissues (4.60±2.959) and significantly decreased in sensitive tissues (1.88±2.082). The difference was statistically significant (P<0.05). Analyzing the follow-up data of 72 patients with ovarian cancer in our hospital, we found that the expression level of miR-382-5P in ovarian cancer patients was correlated with the degree of drug resistance, and the difference was statistically significant (P<0.05). The expression level of miR-382-5P, drug resistance , recurrence and treatment response in patients with ovarian cancer were correlated with their overall survival (OS), and the difference was statistically significant (P<0.05). The expression level of miR-382-5P, drug resistance, treatment response, recurrence and residual lesion size in patients with ovarian cancer were correlated with their progression-free survival (PFS), the difference was statistically significant (P<0.05). Multidrug resistance is an independent risk factor affecting the prognosis of ovarian cancer, the difference was statistically significant (P<0.05) Conclusion ： After comprehensive analysis, it is found that miR-382-5P may become a new target for the treatment of multidrug resistant ovarian cancer. The signal pathways of MAPK, Fox-1,apoptosis and so on may be the main mechanism of miR-382-5P mediating the occurrence and development of ovarian cancer, and lay a certain foundation for the research of targeted miR-382-5P in the treatment of multidrug resistant ovarian cancer.

show abstract

Downregulation of miR-382 by propranolol inhibits the progression of infantile hemangioma via the PTEN-mediated AKT/mTOR pathway

Cited by 39 publications

References 27 publications

Retracted: Propranolol suppresses HUVEC viability, migration, VEGF expression, and promotes apoptosis by downregulation of miR‐4295

Retracted: Propranolol suppresses HUVEC viability, migration, VEGF expression, and promotes apoptosis by downregulation of miR‐4295

Angiostatin Levels in Systolic Heart Failure Patients with Chronic Kidney Disease

Analysis of the expression and clinical significance of miR-382-5P in ovarian cancer based on biological information

Contact Info

Product

Resources

About