DNA triplex formation of oligonucleotide analogs consisting of linker groups and octamer segments that have opposite sugar-phosphate backbone polarities

Abstract

The DNA oligomer analogues 3'd(CTTTCTTT)5'-P4-5'd(TTCTTCTT)3' (IV), 5'd-(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5' (V), and 5'd(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5'-P4-5'd-(TTCTTCTT)3' (VI) (P2 = P*P and P4 = P*P*P*P, where P = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5'd(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'.5'd(TTCTTCTTAAA- GAAAGGGCTTTCTTT)3' (I), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5'd(TTCTTCTT)3' (II) and 5'd(TTTCTTTC)3' (III) and the linked oligomer analogues IV-VI with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was I-V much much greater than I-IV greater than I-(II, III). The mixture of I and VI showed two transitions corresponding to the dissociation of the third strand. The higher transition corresponded to the dissociation of 3'-3'-linked octamer segments, and the lower one corresponded to the dissociation of 5'-5'-linked octamer segments. The Tm of the latter transition was higher than that of the I-IV triplex; thus the triplex formed by the 5'-5'-linked octamer segment was stabilized by the triplex formed by the 3'-3'-linked octamer segments in the I-VI triplex. Triplex formation of this system was also studied in the presence of ethidium bromide.(ABSTRACT TRUNCATED AT 250 WORDS)

DNA triple helices: Biological consequences and therapeutic potential

“…These modifications have assisted in preventing the formation of unwanted intramolecular secondary structures within the TFOs. In the parallel pyrimidine triplex motif, the substitution of cytosine by 5-methylcytosine, N 6 -methyl-8-oxo-2-deoxyadenosine [52,53] or pseudoisocytodines [54] has been used to reduce the pH dependence of triplex formation. At neutral pH, the substitution of thymine by 5-propynyluracil stabilizes triplex formation [55].…”

Sequence specificity of the non-natural pyrido[2,3-d]pyrimidine nucleoside in triple helix formation

“…Pyrimidine-rich oligodeoxyribonucleotides bind parallel to the Watson-Crick purine strand through formation of Hoogsteen hydrogen bonds between thymine (T) and adenine-thymine (AT) base pairs (T AT) and between protonated cytosine (C +) and guanine -cytosine (GC) base pairs (C +GC) (1-4), whereas purine-rich oligodeoxyribonucleotides bind antiparallel to the Watson-Crick purine strand through reverse Hoogsteen hydrogen bond formation between G and GC base pairs and A or T and AT base pairs (5)(6)(7)(8). The discovery of other natural and non-natural base triplets (9)(10)(11)(12)(13)(14)(15)(16)(17)(18) and the use of alternate strand triple-helix formation (19)(20)(21)(22)(23). has increased the number of double-helical sequences that can be recognized beyond simple purine tracts.…”

Formation and characteristics of an unusual λ‐DNA species

“…This phenomenon may result from the influence of orientation projections and/or the effect of DNA species A formation partly inhibiting the binding of DNase I. The latter interpretation is supported by the current concept that triplex DNA formation can inhibit the formation of DNA-protein complex [26]. There is no direct evidence to show the existence of DNA species A in any cell or tissue.…”

“…This thermal melting behavior demonstrates typical characteristics of cooperative melting of longer and ordered DNA molecules. On the other hand, the CD characteristics of DNA species A are significantly different from the properties of known duplex DNA [22][23][24], triplex DNA [25][26], and quadruplexeies DNA [27], and self-assembled structure of single-stranded DNA induced by "protein [22], indicating the existence of a novel and ordered structure of DNA species A.…”