DNA supercoiling restricts the transcriptional bursting of neighboring eukaryotic genes

Implication of polymerase recycling for nascent transcript quantification by live cell imaging

“…It has been described that the polymerase initiates transcription at a slow rate and becomes more processive as it moves along the gene (Jonkers & Lis, 2015). In contrast, the accumulation of DNA supercoiling could slow down the transcription on longer genes (Patel et al, 2023). To display a similar relative intensity on an 8 kB and a 3 kB gene, a polymerase on a 3 kB gene should have on average a 2.5 slower speed.…”

Transcription factor exchange enables prolonged transcriptional bursts

“… 15 N/A pTL174: pURA SIV P RPL15A PCP-NLS-GFPEnvy Brouwer et al., 37 Patel et al. 55 Addgene 189941 pTL131/pML104 Laughery et al. 56 Addgene 67638 pTL363: pML104 with gRNA to GAL4 (GGTGAAGGCCCTACTGAGCC) Brouwer et al.…”

“…PP7 coat proteins (PCP) were either expressed from plasmid pTL092 or integrated in one of the parent strains using PacI-digested plasmid pTL174. 37 , 55 …”

Time will tell: comparing timescales to gain insight into transcriptional bursting

“…Other mechanisms may potentially also contribute to this feedback. For example, one possibility is that the dissolution of the cluster in these examples is caused by DNA supercoiling generated by transcription, which can destabilize DNA-bound factors and block transcription [ 99 , 100 ]. In addition, such a negative feedback loop may arise if these clusters coactivate noncoding transcription at enhancers, which then dislodges DNA-bound TFs and dissolves the cluster [ 101 ].…”

“…Recent literature also reveals increasing examples of gene pairs showing coupled transcription. In budding yeast, coupled bursting is observed at neighboring GAL genes [ 100 ]. Although coupling is strongest for GAL genes in the divergent orientation, tandem genes also show some degree of coupled initiation.…”