DNA secondary structures: stability and function of G-quadruplex structures

Abstract

In addition to the canonical double helix, DNA can fold into various other inter- and intramolecular secondary structures. Although many such structures were long thought to be in vitro artefacts, bioinformatics demonstrates that DNA sequences capable of forming these structures are conserved throughout evolution, suggesting the existence of non-B-form DNA in vivo. In addition, genes whose products promote formation or resolution of these structures are found in diverse organisms, and a growing body of work suggests that the resolution of DNA secondary structures is critical for genome integrity. This Review focuses on emerging evidence relating to the characteristics of G-quadruplex structures and the possible influence of such structures on genomic stability and cellular processes, such as transcription.

Binding of G-quadruplexes to the N-terminal Recognition Domain of the RNA Helicase Associated with AU-rich Element (RHAU)

“…Quadruplex Production and Purification-Synthetic hTR [1][2][3][4][5][6][7][8][9][10][11][12][13][14][15][16][17][18][19][20] RNA (5Ј-GGGUUGCGGAGGGUGGGCCU-3Ј, where the underlining highlights the guanines; Integrated DNA Technologies) was dissolved in 20 mM HEPES, pH 7.5, 100 mM KCl, 1 mM EDTA at a concentration of 5 M. RNA was heated to 95°C for 5 min, allowed to passively cool to room temperature outside the heat bath, and then purified by SEC on a HiLoad Superdex TM 75 26/60 size exclusion chromatography column (Ä KTA FPLC , GE Healthcare). Synthetic DNA quadruplexes (Alpha DNA, Canada) were dissolved in the above HEPES buffer but without adding EDTA, heated to 95°C, and allowed to cool slowly to room temperature inside the metal heat block or water bath.…”

“…All DNA synthesis batches exhibited the same result. Extinction coefficients (⑀ 260 nm ) were calculated from the sequence using IDT SciTools (PrimerQuest program, Integrated DNA Technologies) and corrected for hyperchromicity using the absorption spectra at 20 and 80°C: hTR [1][2][3][4][5][6][7][8][9][10][11][12][13][14][15][16][17][18][19][20] (22) and dsRNA (HIV-1 trans-activation response element, GGUCUCUCUGGUUAAGCCAGAUCUGAGCCUG-GGAGCUCUCUGGCUAACUAGGGAACC) (29) controls were used.…”

“…We next purified the DNA equivalent of hTR [1][2][3][4][5][6][7][8][9][10][11][12][13][14][15][16][17][18][19][20] (DNA [1][2][3][4][5][6][7][8][9][10][11][12][13][14][15][16][17][18][19][20] ) by SEC to compare it with its RNA counterpart. The procedure separated two distinct DNA conformations, suggesting that although both species have identical molecular weight they may differ slightly in terms of their solution conformation (Fig.…”

“…G-quadruplex structures spontaneously fold from RNA or DNA sequences containing consecutive runs of two or more adjacent guanines (G-tracts) and assemble into stable stacks of planar G-quartets that are stabilized by -stacking interactions (1)(2)(3)(4)(5)(6)(7). Quadruplexes are further stabilized by monovalent cations (typically K ϩ or Na ϩ ) that interact with guanine O6 oxygens at the center of the quadruplex (8).…”

Targeting G-Quadruplex DNA Structures by EMICORON Has a Strong Antitumor Efficacy against Advanced Models of Human Colon Cancer

“…G-quadruplex (G4) ligands are small molecules able to bind to and stabilize G4 structures widely described at the telomeric ends of chromosomes (1)(2)(3)(4)(5)(6). Interest in the more general therapeutic significance of G4 has expanded during the past decade including G4 structures in the promoters of a wide range of genes important in cell signaling, recognized as hallmarks of cancer.…”