DNA Polymerase δ Is Highly Processive with Proliferating Cell Nuclear Antigen and Undergoes Collision Release upon Completing DNA

Langston, Lance D.; O'Donnell, Mike

doi:10.1074/jbc.m804488200

Cited by 78 publications

(85 citation statements)

References 56 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In the presence of polδ, the ATPγS assembled RFC · PCNA · DNA complex has been shown to support primer extension although the processivity of the replication was severely limited-tens of nucleotides vs. >5;000 nucleotides incorporated (24,39). With ATP, the key issue is which of these two populations supports holoenzyme function.…”

Section: Resultsmentioning

confidence: 99%

Stepwise loading of yeast clamp revealed by ensemble and single-molecule studies

Kumar

Nashine

Mishra

et al. 2010

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

In ensemble and single-molecule experiments using the yeast proliferating cell nuclear antigen (PCNA, clamp) and replication factor C (RFC, clamp loader), we have examined the assembly of the RFC · PCNA · DNA complex and its progression to holoenzyme upon addition of polymerase δ (polδ). We obtained data that indicate (i) PCNA loading on DNA proceeds through multiple conformational intermediates and is successful after several failed attempts; (ii) RFC does not act catalytically on a primed 45-mer templated fork; (iii) the RFC · PCNA · DNA complex formed in the presence of ATP is derived from at least two kinetically distinguishable species; (iv) these species disassemble through either unloading of RFC · PCNA from DNA or dissociation of PCNA into its component subunits; and (v) in the presence of polδ only one species converts to the RFC · PCNA · DNA · polδ holoenzyme. These findings redefine and deepen our understanding of the clamp-loading process and reveal that it is surprisingly one of trial and error to arrive at a heuristic solution.DNA replication | replication factor C | single-molecule FRET D NA replication is carried out by effective coordination of the activities of many proteins at the replication fork. Given the complex nature of DNA synthesis, a structural and functional conservation of the accessory proteins apparently has evolved across diverse organisms (1-3). However, eukaryotic DNA replication has diverged and become more complicated than its prokaryotic counterpart due in part to the multisubunit composition of several proteins. In yeast, lagging strand DNA synthesis requires the coordinated actions of polymerase δ (polδ), proliferating cell nuclear antigen (PCNA), and replication factor C (RFC) (4). Eukaryotic PCNA, a ring-shaped trimer of identical subunits, plays a pivotal role in both DNA replication and repair by tethering the DNA polymerase to significantly enhance the processivity of DNA synthesis (5-10). The productive assembly of a polymerase-PCNA complex bound to DNA requires loading of the PCNA clamp by RFC (11). RFC, an ATP-driven motor, is composed of a large subunit (RFC-A, 95 kDa) and four small subunits (RFC-B-RFC-E, 36-40 kDa) and forms a RFC · PCNA · ATP complex that binds specifically to primed DNA (12).The clamp-loading process occurs via multiple steps (13-16). X-ray crystallographic and electron microscopic studies of the clamp loader complexed with the clamp revealed that PCNA was either in a closed or slightly open conformation that perhaps represents the structure of an intermediate step in PCNA loading (13,17). PCNA, in solution, has a closed conformation and must be opened for loading on DNA and further reclosed to be retained on the DNA possibly through a specific single interface (18).The structure of the yeast RFC · PCNA complex (13) provided the coordinates for introducing a fluorescent donor-acceptor pair within the PCNA to probe the FRET efficiencies distance information on the conformation of the PCNA subunit interface (19). In the presence of ATP, the PCNA...

show abstract

Section: Resultsmentioning

confidence: 99%

Stepwise loading of yeast clamp revealed by ensemble and single-molecule studies

Kumar

Nashine

Mishra

et al. 2010

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

show abstract

“…The assay was basically performed as described by Langston and O'Donnell (Langston & O'Donnell, 2008). ϕX174 virion circular ssDNA (0.5 nM) primed with a 70‐mer (5′‐CAAAACGGCAGAAGCCTGAATGAGCTTAATAGAGGCCAAAGCGGTCTGGAAACGTACGGATTGTTCAGTA‐3′) was incubated with PCNA (10 nM), RFC (17.5 nM), RPA (75 nM) and Polδ (10 nM) in buffer REP (20 mM Tris–HCl pH 7.5, 1 mM DTT, 12 mM MgCl 2 , 50 mM KCl, 0.1 μg/μl BSA, 0.09 μM dCTP, 0.09 μM dGTP, 1.25 mM ATP and an ATP‐regenerating system consisting of 20 mM creatine phosphate and 20 μg/ml creatine kinase) for 5 min at 30°C.…”

Section: Methodsmentioning

confidence: 99%

Unloading of homologous recombination factors is required for restoring double‐stranded DNA at damage repair loci

et al. 2017

View full text Add to dashboard Cite

Cells use homology‐dependent DNA repair to mend chromosome breaks and restore broken replication forks, thereby ensuring genome stability and cell survival. DNA break repair via homology‐based mechanisms involves nuclease‐dependent DNA end resection, which generates long tracts of single‐stranded DNA required for checkpoint activation and loading of homologous recombination proteins Rad52/51/55/57. While recruitment of the homologous recombination machinery is well characterized, it is not known how its presence at repair loci is coordinated with downstream re‐synthesis of resected DNA. We show that Rad51 inhibits recruitment of proliferating cell nuclear antigen (PCNA), the platform for assembly of the DNA replication machinery, and that unloading of Rad51 by Srs2 helicase is required for efficient PCNA loading and restoration of resected DNA. As a result, srs2Δ mutants are deficient in DNA repair correlating with extensive DNA processing, but this defect in srs2Δ mutants can be suppressed by inactivation of the resection nuclease Exo1. We propose a model in which during re‐synthesis of resected DNA, the replication machinery must catch up with the preceding processing nucleases, in order to close the single‐stranded gap and terminate further resection.

show abstract

“…In fact, human Pol δ is known to be distributive with PCNA (25), and barring stability by another protein, quality control on the leading strand may be explained by spontaneous dissociation in humans. We note that different processivity values of S. cerevisiae Pol δ-PCNA are reported, which probably depend on the substantially different ionic strengths used in the studies, but could also possibly be due to different methods of protein preparation (12,13). It is important to note that the intracellular salt in yeast is not yet identified, nor has the intracellular ionic strength of S. cerevisiae been determined.…”

Section: Quality Control Of Polmentioning

confidence: 99%

“…However, our earlier studies made the perplexing observation that Pol e was incapable of lagging strand synthesis even in the absence of Pol δ (9, 10). We and others have shown that S. cerevisiae Pol δ-PCNA is rapid, over 100 bp/s, and its processivity varies depending on ionic strength (12,13). The intracellular ionic strength of S. cerevisiae is unknown, but at ionic strength under 70 mM, Pol δ-PCNA is highly processive for over 5 kb (13).…”

mentioning

confidence: 99%

“…We and others have shown that S. cerevisiae Pol δ-PCNA is rapid, over 100 bp/s, and its processivity varies depending on ionic strength (12, 13). The intracellular ionic strength of S. cerevisiae is unknown, but at ionic strength under 70 mM, Pol δ-PCNA is highly processive for over 5 kb (13). Surprisingly, under these highly processive conditions Pol δ-PCNA exhibited poor and distributive activity with CMG on the leading strand (10).…”

mentioning

confidence: 99%

See 1 more Smart Citation

Quality control mechanisms exclude incorrect polymerases from the eukaryotic replication fork

Schauer

O'Donnell

2017

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

The eukaryotic genome is primarily replicated by two DNA polymerases, Pol e and Pol δ, that function on the leading and lagging strands, respectively. Previous studies have established recruitment mechanisms whereby Cdc45-Mcm2-7-GINS (CMG) helicase binds Pol e and tethers it to the leading strand, and PCNA (proliferating cell nuclear antigen) binds tightly to Pol δ and recruits it to the lagging strand. The current report identifies quality control mechanisms that exclude the improper polymerase from a particular strand. We find that the replication factor C (RFC) clamp loader specifically inhibits Pol e on the lagging strand, and CMG protects Pol e against RFC inhibition on the leading strand. Previous studies show that Pol δ is slow and distributive with CMG on the leading strand. However, Saccharomyces cerevisiae Pol δ-PCNA is a rapid and processive enzyme, suggesting that CMG may bind and alter Pol δ activity or position it on the lagging strand. Measurements of polymerase binding to CMG demonstrate Pol e binds CMG with a K d value of 12 nM, but Pol δ binding CMG is undetectable. Pol δ, like bacterial replicases, undergoes collision release upon completing replication, and we propose Pol δ-PCNA collides with the slower CMG, and in the absence of a stabilizing Pol δ-CMG interaction, the collision release process is triggered, ejecting Pol δ on the leading strand. Hence, by eviction of incorrect polymerases at the fork, the clamp machinery directs quality control on the lagging strand and CMG enforces quality control on the leading strand.D uplication of genetic material is performed by a dynamic interplay of numerous different proteins, collectively referred to as the replisome, that orchestrate their actions to accomplish efficient, high-fidelity replication of both the leading and lagging strands (1-3). Eukaryotes possess several replisome factors that have no homologs in bacteria, and also require two different DNA polymerases for bulk leading and lagging strand synthesis, and Escherichia coli and its phages use identical copies of a DNA polymerase for both strands of the duplex (4). Thus far, the evolutionary purpose behind the additional complexity in eukaryotes is unclear.At the heart of the eukaryotic replisome is an 11-subunit helicase complex referred to as CMG (Cdc45-Mcm2-7-GINS) (5-7). Eukaryotes use three different multisubunit B-family DNA polymerases (Pol) for replication. Pol e and Pol δ copy the bulk of the genome, and Pol α-primase generates hybrid RNA-DNA primers of about 25 nucleotides and, unlike Pol e and Pol δ, it lacks 3′-5′ exonuclease (proofreading) activity. The replication factor C (RFC) clamp loader is used to load PCNA (proliferating cell nuclear antigen) clamps onto primed sites that endow the replicative polymerases with high processivity (8). The replication protein A (RPA) heterotrimer binds and protects the single-strand (ss) DNA of the lagging strand against nucleases, and helps melt secondary structure in ssDNA. Reconstitution of the core eukaryotic replisome using all thre...

show abstract

DNA Polymerase δ Is Highly Processive with Proliferating Cell Nuclear Antigen and Undergoes Collision Release upon Completing DNA

Cited by 78 publications

References 56 publications

Stepwise loading of yeast clamp revealed by ensemble and single-molecule studies

Stepwise loading of yeast clamp revealed by ensemble and single-molecule studies

Unloading of homologous recombination factors is required for restoring double‐stranded DNA at damage repair loci

Quality control mechanisms exclude incorrect polymerases from the eukaryotic replication fork

Contact Info

Product

Resources

About