DNA methylation and gene expression profiles show novel regulatory pathways in hepatocellular carcinoma

Abstract

BackgroundAlcohol is a well-known risk factor for hepatocellular carcinoma (HCC), but the mechanisms underlying the alcohol-related hepatocarcinogenesis are still poorly understood. Alcohol alters the provision of methyl groups within the hepatic one-carbon metabolism, possibly inducing aberrant DNA methylation. Whether specific pathways are epigenetically regulated in alcohol-associated HCC is, however, unknown. The aim of the present study was to investigate the genome-wide promoter DNA methylation and gene expression profiles in non-viral, alcohol-associated HCC. From eight HCC patients undergoing curative surgery, array-based DNA methylation and gene expression data of all annotated genes were analyzed by comparing HCC tissue and homologous cancer-free liver tissue.ResultsAfter merging the DNA methylation with gene expression data, we identified 159 hypermethylated-repressed, 30 hypomethylated-induced, 49 hypermethylated-induced, and 56 hypomethylated-repressed genes. Notably, promoter DNA methylation emerged as a novel regulatory mechanism for the transcriptional repression of genes controlling the retinol metabolism (ADH1A, ADH1B, ADH6, CYP3A43, CYP4A22, RDH16), iron homeostasis (HAMP), one-carbon metabolism (SHMT1), and genes with a putative, newly identified function as tumor suppressors (FAM107A, IGFALS, MT1G, MT1H, RNF180).ConclusionsA genome-wide DNA methylation approach merged with array-based gene expression profiles allowed identifying a number of novel, epigenetically regulated candidate tumor-suppressor genes in alcohol-associated hepatocarcinogenesis. Retinol metabolism genes and SHMT1 are also epigenetically regulated through promoter DNA methylation in alcohol-associated HCC.Due to the reversibility of epigenetic mechanisms by environmental/nutritional factors, these findings may open up to novel interventional strategies for hepatocarcinogenesis prevention in HCC related to alcohol, a modifiable dietary component.Electronic supplementary materialThe online version of this article (doi:10.1186/s13148-015-0077-1) contains supplementary material, which is available to authorized users.

Hepcidin and DNA promoter methylation in hepatocellular carcinoma

“…Were also excluded patients with decompensated liver cirrhosis (Child‐Pugh B, C), autoimmune liver diseases or hereditary haemochromatosis or with other relevant concurrent medical conditions such as acute or chronic inflammatory diseases and/or haematological disorders. Surgical resectability criteria were the presence of a preserved liver function, Child‐Pugh class A, the presence of a resectable single tumour or oligofocal resectable nodules and the absence of extrahepatic metastases, as previously reported …”

“…Genomic DNA was extracted from HCC and N tissues of 28 patients by a standard phenol/chloroform method. The region of interest was selected among the ones resulted differentially methylated in HCC tissues, according to our previous observations, and it was located in of the region −940 bp/−398 bp from the transcription start site (TSS). PCR primers specific for bisulphite‐converted genomic DNA were designed with Sequenom EpiDesigner (http://www.epidesigner.com/start3.html): forward primer ATGTTGGGGGAAGTATTTATTGTTT, reverse primer ATCTACCTCAACCTCCCAAATAACT.…”

Heterogeneity of Hepatocellular Carcinoma

“…The study of Udali et al (2015) used array-based DNA methylation and gene expression data of all annotated genes from eight HCC patients undergoing curative surgery to analyze by comparing HCC tissue and homologous cancer-free liver tissue. They identified 159 hypermethylated-repressed, 56 hypomethylatedrepressed, 49 hypermethylated-induced, and 30 hypomethylated-induced genes.…”

Reply

“…These findings are also substantiated by a recent report in which we observed a peculiar tissue pattern of gene-specific methylation in hepatocellular carcinoma. (4) Larger studies with a longer follow-up period for the analysis of factors that, together with DNA methylation and hydroxymethylation, are potentially associated with survival rates in hepatocellular carcinoma and cholangiocarcinoma are certainly warranted. Several tumor features are recognized as being important determinants of survival, such as severity of underlying liver disease, tumor size and extension into adjacent structures, and presence of metastases; however, reliable prognostic biomarkers from an easily achievable blood sample withdrawal are, so far, limited for both hepatocellular carcinoma and cholangiocarcinoma.…”