DNA demethylation during the differentiation of 3T3-L1 cells affects the expression of the mouse GLUT4 gene.

Abstract

GLUT4 is the major glucose transporter in adipose tissue and skeletal and cardiac muscles. We examined the mechanisms underlying GLUT4 gene expression in 3T3-L1 cells, which express the gene during their differentiation from preadipocytes to adipocytes. In transient transfections, the activity of a mouse GLUT4 promoter extending to -100 bp in the 5'-flanking region did not differ significantly between 3T3-L1 preadipocytes and adipocytes. Promoter activity up to -590 bp in preadipocytes and adipocytes showed a 70% lower and 228% higher activity, respectively, than promoter activity extending to -100 bp. We also examined methylation status of the GLUT4 promoter. Up to -100 bp, there were five CpG sites at -11, -30, -58, -63, and -75 bp. Two CpG sites at -11 and -30 bp were highly methylated in preadipocytes (60 and 92%, respectively) and highly demethylated in adipocytes (28.6 and 25%, respectively). Conversely, three CpG sites at -58, -63, and -75 bp were highly demethylated in both preadipocytes and adipocytes (<12%). In gel mobility-shift assays, a fragment extending from -40 to -1 bp generated a methylation-sensitive band with nuclear extracts from both preadipocytes and adipocytes when the CpG sites were methylated. Southwestern analysis identified a protein of approximately 55 kDa that bound strongly to the methylated probe. Furthermore, methylation of the CpG sites inhibited promoters extending to -50 or -70 bp. These results suggest that in addition to cell type-specific transcription factor, methylation of specific CpG sites and the methylation-sensitive transcription factor contribute to GLUT4 gene regulation during 3T3-L1 differentiation.

DNA demethylation modulates mouse leptin promoter activity during the differentiation of 3T3-L1 cells

“…We have also shown that GLUT4 gene transcription during adipocyte differentiation is regulated by the 96 kM r repressor protein [24]. When we examined the mechanism underlying GLUT4 gene induction during the differentiation of 3T3-L1 cells, we also found that the methylation of specific CpG sites and the methylationsensitive transcription factor contribute to GLUT4 gene regulation [5]. In this study, we found that methylation of specific CpG sites also modulated the leptin promoter activity during adipocyte differentiation.…”

“…The molecular weight of this protein differs from those of previously reported methyl-CpG-binding proteins, including MeCP2 [28±33] but is close to that of the 55 kM r methyl-CpG-binding protein that binds to the GLUT4 gene promoter [5]. The 55 kM r protein was observed to recognize the demethylation of the GLUT4 gene during the differentiation of 3T3-L1 preadipocytes to adipocytes.…”

“…5'-gatc ±40 TTCAGCTCTCCGCATCTTTCCCCCTCAAGCG GGTCTCACT ±1 for the unmethylated GLUT4 probe, and 5'-gatc ±40 TTCAGCTCTCm 5 CGCATCTTTCCCCCTCAAGm 5 -CGGGTCTCACT ±1 for the methylated GLUT4 probe. The latter two were identical to the probes used in the experiments of the analysis of the GLUT4 gene promoter [5]. Filters were washed with several changes of washing buffer (10 mmol/l HE-PES pH 7.4, 1 mmol/l EDTA, 60 mmol/l NaCl, 1 mmol/l DTT, 0.25 % non-fat milk powder), then dried, exposed to an imaging plate and analysed with a Bas 2000 image analyzer (Fuji).…”

“…In addition, DNA methylation could also play an important role during the process of adipocyte differentiation. We recently showed that methylation of specific CpG sites of the GLUT4 gene and a methylation sensitive transcription factor, contribute to GLUT4 gene regulation during 3T3-L1 differentiation [5]. Similar mechanisms could also regulate the expression of other genes induced during adipocyte differentiation.…”

Epigenetic reprogramming and imprinting in origins of disease

“…Additionally, differential DNA methylation was observed in promoters of genes involved in glucose metabolism. These include the facilitative glucose transporter 4 [54] and the uncoupling protein 2 [55]. Both are major targets involved in the development of type 2 diabetes.…”