Diversity of Taenia and Hydatigera (Cestoda: Taeniidae) in domestic dogs in Kenya

Mulinge, Erastus; Odongo, David; Magambo, Japhet; Njenga, Sammy M.; Zeyhle, E.; Mbae, Cecilia; Kagendo, Dorothy; Addy, Francis; Ebi, Dennis; Wassermann, Marion; Kern, Peter; Römig, Thomas

doi:10.1007/s00436-020-06793-2

Cited by 7 publications

(13 citation statements)

References 67 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In both reserves the 'lion strain´ E. felidis could be isolated from both wild carnivores and domestic dogs. The lion strain, E. felidis was first promoted to the species status in 2009 where it was described as a lion strain probably confined to sylvatic transmission in sub-Saharan Africa [33]. Subsequently, E. felidis was isolated from wildlife in Kenya [9] and South Africa [46].…”

Section: Discussionmentioning

confidence: 99%

“…The genotype, is rare in wildlife and its existence in a domestic dog fecal sample collected from the heart of the Reserve cannot guarantee its wildlife origin. [33]. Possibly, the dog acquired the infection from the domestic setting and defecated at the heart of the Reserve during regular human visits to the area such as herding or collection of firewood mostly by Samburu Morans who often visited the heart of the Reserve often accompanied by their dogs [9].…”

Section: Discussionmentioning

confidence: 99%

“…The pathogenicity of E. felidis to domestic animals remains unknown. In 2014, Kagendo et al, isolated E. granulosus s. s. eggs from lion feces, however the extent of actual transmission in the wildness or how the lions contracted the taxa was a mare speculation, since there were only a few reports showing the taxa to have been isolated in a stool sample from a warthog [33]. The present study aimed to evaluate the interaction of the sylvatic and domestic cycles of this zoonotic disease in areas adjacent to the national reserves in Kenya.…”

Section: Echinococcosis: a Zoonotic Diseasesmentioning

confidence: 99%

“…Amplification of a 200 bp long fragment of nad1 was done in a primary PCR using Nadnest A 5'-TGTTTTTGAGATCAGTTCGGTGTG3' and Nadnest C 5' CATAATCAAACGGAGTACGATAG −3′ primers in a 25 μl mix that was constituted using 1x dream Taq green buffer (20 nM Tris-HCl pH 8), 0.2 mM dNTPs, 0.25 μM of each forward and reverse primer, 2 mM MgCl 2 and 0.625 U of dream Taq green DNA polymerase (Thermo scientific) and 2 μl of the target DNA template. A nested PCR was done using Nadnest 5' _ B CAGTTCGGTGTGCTTTTGGGTCTG-3′ and Nadnest D 5'-GAGTACGATTAGTCTCACACAGCA primers in a 25 μ mixture of same constitution as the primary PCR the use of 1 μl of the of the primary PCR amplicon as a source of DNA template [33]. Cycling conditions of primary and nested PCRs were the same; initial denaturation for 5 minutes at 94°C, and a 35-cycle involving denaturation at 94 0 Cfor 30 s, elongation at 55°C for 30 s and annealing at 72°C for 1 minutes., and a final extension at 72°C for 5 minutes.…”

Section: Polymerase Chain Reaction and Gene Sequencing Of Nad1 Positimentioning

confidence: 99%

“…Host specificity of all taeniid positive samples from the environment of the parks were done by a method previously described [33]. A PCR system using primer pairs forward 5'-TCATTCATTGA(C/T) CT(C/T) CCCAC(C/T) CCA-3'and reverse 5'-ACGGTA(A/G) GACATA(A/T) CC(C/T) ATGAA(G/T) G-3′ for primary reaction and a secondary reaction with primer pairs forward CA(C/T) CCAA(C/T) ATCTCAGCATGAA and reverse 5′-(G/T) GC(G/T) GTAGCTAT(A/T) ACTGTGAA(C/T) A(A/G)-3′ were used to amplify partial fragment of the cob gene.…”

Section: Wild Carnivore Host Identificationmentioning

confidence: 99%

See 4 more Smart Citations

Interlinks between Wildlife and Domestic Cycles of Echinococcus spp. in Kenya

Kagendo¹,

Muchiri²,

Gitonga³

et al. 2021

Managing Wildlife in a Changing World

Self Cite

View full text Add to dashboard Cite

Effective conservation and management of wildlife in the current changing world, call for incorporation of infectious zoonotic diseases surveillance systems, among other interventions. One of such diseases is echinococcosis, a zoonotic disease caused by Echinococcus species. This disease exists in two distinct life cycle patterns, the domestic and wildlife cycles. To investigate possible inter-links between these cycles in Kenya, 729 fecal samples from wild carnivores and 406 from domestic dogs (Canis lupus familiaris) collected from Maasai Mara and Samburu National Reserves were analyzed. Taeniid eggs were isolated by zinc chloride sieving-flotation method and subjected to polymerase chain reaction of nicotinamide adenine dehydrogenase subunit 1 (NAD1). Subsequent amplicons were sequenced, edited and analyzed with GENtle VI.94 program. The samples were further subjected to molecular identification of specific host species origin. All sequences obtained were compared with those in Gene-bank using Basic Local Alignment Search Tool (BLAST). The study found that there were 74 taeniid positive samples, 53 from wild carnivores and 21 from domestic dogs. In wildlife, mixed infections with Echinococcus and Taenia species were identified and these included E. granulosus sensu stricto, E. felidis, T. canadensis G6/7, Taenia hydatigena, T. multiceps, and T. saginata. Domestic dogs harbored Echinococcus and Taenia species similar to wild carnivores including E. granulosus G1–3, E. felidis, T. multiceps, T. hydatigena, and T. madoquae. Taenia species of nine taeniid eggs were not identified. Majority of genotypes were found in hyena (Crocuta crocuta) fecal samples. Distribution of Echinococcus and Taenia spp. varied with hosts. Mixed infections of Echinococcus spp, T. multiceps and T. hydatigena in a single animal were common. There seemed to be existence of interactions between the two cycles, although public health consequences are unknown. The presence of T. saginata in hyena suggests scavenging of human fecal matter by the animal. In addition, presence of T. multiceps, T hydatigena, T madoquae and T. saginata in the two cycles suggested possible human exposure to these parasites. The results are important in drawing up of strategies and policies towards prevention and control of Echinococcosis and other Taenia related parasitic infections, especially in endemic areas given their potential risk to public and socio- economic livelihood.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Discussionmentioning

confidence: 99%

Section: Echinococcosis: a Zoonotic Diseasesmentioning

confidence: 99%

Section: Polymerase Chain Reaction and Gene Sequencing Of Nad1 Positimentioning

confidence: 99%

Section: Wild Carnivore Host Identificationmentioning

confidence: 99%

See 3 more Smart Citations