Diverse ETS transcription factors mediate FGF signaling in the Ciona anterior neural plate

Abstract

The ascidian Ciona intestinalis is a marine invertebrate belonging to the sister group of the vertebrates, the tunicates. Its compact genome and simple, experimentally tractable embryos make Ciona well-suited for the study of cell-fate specification in chordates. Tunicate larvae possess a characteristic chordate body plan, and many developmental pathways are conserved between tunicates and vertebrates. Previous studies have shown that FGF signals are essential for neural induction and patterning at sequential steps of Ciona embryogenesis. Here we show that two different ETS family transcription factors, Ets1/2 and Elk1/3/4, have partially redundant activities in the anterior neural plate of gastrulating embryos. Whereas Ets1/2 promotes pigment cell formation in lateral lineages, both Ets1/2 and Elk1/3/4 are involved in the activation of Myt1L in medial lineages and the restriction of Six3/6 expression to the anterior-most regions of the neural tube. We also provide evidence that photoreceptor cells arise from posterior regions of the presumptive sensory vesicle, and do not depend on FGF signaling. Cells previously identified as photoreceptor progenitors instead form ependymal cells and neurons of the larval brain. Our results extend recent findings on FGF-dependent patterning of anterior–posterior compartments in the Ciona central nervous system.

Nodal and FGF coordinate ascidian neural tube morphogenesis

“…Especially striking is the observation that the floor plate is derived entirely from A9.13 and A9.15, whereas A9.14 contributes only to the sensory vesicle. It seems probable that A9.14 gives rise to the lateral portions of the 'middle sensory vesicle' identified by Nakamura et al (2012), which is consistent with studies suggesting that the photoreceptors of the ocellus are derived from the medial A-lineage (Gainous et al, 2015;Taniguchi and Nishida, 2004). It therefore appears that the basic subdivision of the posterior CNS into middle sensory vesicle, posterior sensory vesicle, visceral ganglion, lateral nerve cord and floor plate is already established at the mid-gastrula stage, similar to the time when CNS patterning becomes evident in vertebrates (Lumsden and Krumlauf, 1996).…”

“…To do so, we overexpressed a constitutively active form of the FGF/MAPK transcriptional effector Elk:VP64, which is a member of Ets family of transcription factors (Gainous et al, 2015). Co-electroporation of embryos with a FoxB>Elk:VP64 transgene and Mnx>H2B:Cherry reporter resulted in ectopic expression of the Mnx reporter in A9.14 and A9.16 derivatives (Fig.…”

“…The Mnx −5 kb regulatory sequence was amplified from genomic DNA using the primers F-TATGGCGCGCCTCCTGATGTGACGGATTTATGACTG, R-TATG-CGGCCGCTAGCATCATTTTAAATCTTAAATATCAAAGGTTC and cloned into a H2B:Cherry-containing expression vector using NotI and AscI restriction sites. dnFGFR and Elk:VP64 were digested from Dmrt4> dnFGFR (Wagner and Levine, 2012) and Zicl>ElkLVP64 (Gainous et al, 2015) using NotI and BlpI and cloned downstream of the FoxB and Mnx enhancers. A clone of the Ciona MEK1/2 gene (citb42j03) was modified to produce the amino acid changes S116D and S220E using the primers TATGATCTTGTCCCTACAAACTCGTTGGCCATATCGTCGATCAGT-TGCCCGCTCAC and GTGAGCGGGCAACTGATCGACGATATGGC-CAACGAGTTTGTAGGGACAAGATCATA and the Stratagene quickchange site-directed mutagenesis procedure.…”

Single-cell transcriptome profiling of theCionalarval brain

“…In addition to these three major brain areas, we unexpectedly detected a small cluster of cells (Cluster 8) that was distinguished by a number of cells expressing markers of epidermal sensory neurons and palp neurons (Supplemental Table 1, sheet 8).They clustered closely to cells in clusters 2, 4, and 10, which appeared to represent various epidermal cells (Supplemental Table 1, sheets 2, 4, & 10). As the name implies, epidermal neurons (as well as palp neurons) are embedded in the epidermis and arise from boundary regions that give rise to both neurons and epidermal cells (Abitua et al, 2015;Gainous et al, 2015;Imai and Meinertzhagen, 2007;Takamura, 1998;Wagner and Levine, 2012). This unintended contamination of epidermal cells and embedded sensory neurons is likely due to leakiness of Fascin>tagRFP that was not counter-selected by Twistrelated.c>eGFP.…”

The central nervous system of ascidian larvae

“…Differential ERK1/2 activation between rows III (ERK1/2 on) and IV (ERK1/2 off) again governs their binary fate choice (Figure (a)). It is not yet clear how this differential activation pattern of ERK1/2 is achieved, though it is most likely explained, at least in part, by the expression pattern of Fgf genes . Differential ERK1/2 activity is continuously observed in a‐line cells following their successive A‐P‐oriented cell divisions (Figure (a)).…”