Distribution of the ΔG210 Protoporphyrinogen Oxidase Mutation in Illinois Waterhemp (Amaranthus tuberculatus) and an Improved Molecular Method for Detection

Abstract

Molecular assays are often implemented by weed scientists for detection of herbicide-resistant individuals; however, the utility of these assays can be limited if multiple mechanisms of evolved resistance exist. Waterhemp resistant to protoporphyrinogen oxidase (PPO)– inhibiting herbicides is conferred by a target-site mutation in PPX2L (a gene coding for PPO), resulting in the loss of a glycine at position 210 (ΔG210). This ΔG210 mutation of PPX2L is the only known mechanism responsible for PPO-inhibitor resistance (PPO-R) in waterhemp from five states (Illinois, Indiana, Iowa, Kansas, and Missouri); however, a limited number of populations have been tested, especially in Illinois. To verify the ubiquity of the ΔG210 in PPO-R waterhemp populations in Illinois, a previously published allele-specific PCR (asPCR) was used for the detection of the ΔG210 mutation to associate this mutation with phenotypic resistance in 94 Illinois waterhemp populations. The ΔG210 mutation was detected in all populations displaying phenotypic resistance to lactofen (220 g ai ha−1), indicating the deletion is likely the only mechanism of resistance. With evidence that the ΔG210 mutation dominates PPO-R waterhemp biotypes, molecular detection techniques have considerable utility. Unfortunately, the previously published asPCR is time consuming, very sensitive to PCR conditions, and requires additional steps to eliminate the possibility of false negatives. To overcome these limitations, a streamlined molecular method using the TaqMan® technique was developed, utilizing allele-specific, fluorescent probes for high-throughput, robust discrimination of each allele (resistant and susceptible) at the 210th amino acid position of PPX2L.

Two new PPX2 mutations associated with resistance to PPO‐inhibiting herbicides in Amaranthus palmeri

“…This assay uses allele‐specific probes to determine whether a plant is wild type or heterozygous/homozygous for the ΔG210 mutation. The only difference between this new assay and the assay given in Wuerfell et al . is new primers that recognize both A. palmeri and A. tuberculatus PPX2 sequence, PA‐tqF1 (5′‐ TGATTATGTTATTGACCCTTTTGTTGCG) and PA‐tqR1 (5′‐ GAGGGAGTATAATTTATTTACAACCTCCAGAA).…”

“…This assay uses allele-specific probes to determine whether a plant is wild type or heterozygous/homozygous for the ΔG210 mutation. The only difference between this new assay and the assay given in Wuerfell et al 9 is new primers that recognize both A. palmeri and wileyonlinelibrary.com/journal/ps Figure 2. Gel image of dCAPS assays for three Amaranthus palmeri plants from population GPW.…”

“…Specifically, the loss of three consecutive nucleotides results in the deletion of a glycine residue at position 210 (ΔG210) of the PPO2 enzyme . The same mutation was subsequently found to be responsible for resistance in numerous other A. tuberculatus populations as well as in A. palmeri and, to date, no other PPO‐inhibitor‐resistance mechanism has been reported in either of these species …”

Origins and structure of chloroplastic and mitochondrial plant protoporphyrinogen oxidases: implications for the evolution of herbicide resistance

“…23 Subsequent surveys demonstrated that the ΔGly210 mutation was ubiquitous among PPO-inhibitor-resistant A. tuberculatus populations. [24][25][26] The ΔGly210 mutation confers broad cross-resistance to most PPO inhibitors. 20,21,27 The highest magnitude of resistance was reported to lactofen, with resistance:sensitive (R:S) ratios ranging from about 20 to 80, whereas resistances to most other PPO inhibitors were more modest and generally <10-fold.…”

“…Described in more detail in the following sections, a deletion of a glycine amino acid (termed ΔGly210) in the PPO2 enzyme confers resistance to PPO inhibitors in A. tuberculatus . Subsequent surveys demonstrated that the ΔGly210 mutation was ubiquitous among PPO‐inhibitor‐resistant A. tuberculatus populations . The ΔGly210 mutation confers broad cross‐resistance to most PPO inhibitors .…”