Distribution and frequency of G119S mutation in ace-1 gene within Anopheles sinensis populations from Guangxi, China

Huang

et al. 2016

Malar J

Self Cite

BackgroundAnopheles sinensis is a major vector of malaria in China and its control is under great threat as the development of insecticide resistance. Voltage-gated sodium channel (VGSC) is the target of several classes of insecticides. Genetic mutations of VGSC have been documented to confer knockdown resistance (kdr) to dichlorodiphenyltrichloroethane (DDT) and pyrethroids in mosquitoes. To control this vector efficiently, it is important to know the resistance-associated genetic mutations, their distribution frequencies and genealogical relations.MethodsThree hundreds and thirteen (313) adults of An. sinensis collected from nine locations across Guangxi Zhuang Autonomous Region were used. The partial sequence of the An. sinensis voltage gated sodium channel gene (AS-VGSC) containing codon 1014 was sequenced. PHASE2.1 was used to construct the haplotypes of each individual, and the accuracy of haplotypes was further confirmed by clone sequencing. The genealogical relations of kdr mutations in AS-VGSC was analysed using TCS 2.1 and Network 5.0.ResultsSixteen AS-VGSC haplotypes including seven haplotypes carrying non-synonymous mutations at codon 1014, and fifty-five AS-VGSC genotypes were identified from 313 mosquitoes collected from nine geographical locations across Guangxi. The number of haplotypes in each of the nine populations ranged from 5 to 13. The frequency of haplotypes carrying kdr mutations ranged from 2.7 to 80.0 % within the nine populations, of which 1014C was unexpectedly high in the northeast of Guangxi. Genealogical analysis suggested multiple origins of kdr mutations in An. sinensis.ConclusionDiverse haplotypes of AS-VGSC are distributed in Guangxi. The presence of haplotypes carrying mutations at codon 1014 indicates a risk of pyrethroid and DDT resistance. The kdr mutations show differential distribution geographically, with high frequencies occurred in the northeast of Guangxi. Genealogical analysis suggests multiple origins of kdr mutations in An. sinensis populations in Guangxi. These findings have important practical implications for the sustainability of An. sinensis control programmes.Electronic supplementary materialThe online version of this article (doi:10.1186/s12936-016-1467-3) contains supplementary material, which is available to authorized users.

Section: Methodsmentioning

confidence: 99%

Diversity and frequency of kdr mutations within Anopheles sinensis populations from Guangxi, China

Huang

et al. 2016

Malar J

Self Cite

“…Genotyping of codon 119 of An. sinensis ace-1 gene was done by PCR-RFLP [12]. The frequency of the G119S mutation in each collection was recorded.…”

Section: Methodsmentioning

confidence: 99%

“…Recent surveys have revealed that the G119S occurs at high frequencies in many field populations of An. sinensis in Asia [12, 13].…”

Section: Introductionmentioning

confidence: 99%

Target-site mutations (AChE-G119S and kdr) in Guangxi Anopheles sinensis populations along the China-Vietnam border

Liu

et al. 2019

Parasites Vectors

Self Cite

BackgroundIn South Asia, the epidemiology of malaria is complex, and transmission mainly occurs in remote areas near international borders. Vector control has been implemented as a key strategy in malaria prevention for decades. A rising threat to the efficacy of vector control efforts is the development of insecticide resistance, thus it is important to monitor the type and frequency of insecticide resistant alleles in the disease vectors such as An. sinensis along the China-Vietnam border. Such information is needed to synthesize effective malaria vector control strategies.MethodsA total of 208 adults of An. sinensis, collected from seven sites in southwest Guangxi along the China-Vietnam border, were inspected for the resistance-conferring G119S mutation in acetylcholinesterase (AChE) by PCR-RFLP (polymerase chain reaction restriction fragment length polymorphism) and kdr mutations in the voltage-gated sodium channel (VGSC) by sequencing. In addition, the evolutionary origin of An. sinensis vgsc gene haplotypes was analyzed using Network 5.0.ResultsThe frequencies of mutant 119S of AChE were between 0.61–0.85 in the seven An. sinensis populations. No susceptible homozygote (119GG) was detected in three of the seven sites (DXEC, LZSK and FCGDX). Very low frequencies of kdr (0.00–0.01) were detected in the seven populations, with most individuals being susceptible homozygote (1014LL). The 1014F mutation was detected only in the southeast part (FCGDX) at a low frequency of 0.03. The 1014S mutation was distributed in six of the seven populations with frequencies ranging from 0.04 to 0.08, but absent in JXXW. Diverse haplotypes of 1014L and 1014S were found in An. sinensis along the China-Vietnam border, while only one 1014F haplotype was detected in this study. Consistent with a previous report, resistant 1014S haplotypes did not have a single origin.ConclusionsThe G119S mutation of AChE was present at high frequencies (0.61–0.85) in the An. sinensis populations along the China-Vietnam border, suggesting that the vector control authorities should be cautious when considering carbamates and organophosphates as chemicals for vector control. The low frequencies (0.00–0.11) of kdr in these populations suggest that pyrethroids remain suitable for use against An. sinensis in these regions.

“…The genomic DNA of individual adult mosquitoes was prepared as described elsewhere [ 11 , 28 ]. A fragment of exon 7 encoding the M2 transmembrane domain region was amplified using primers ASRdl-7F (AGTTTGTACGTTCGATGGGTTA) and ASRdl-7R (CCAGCAGACTGGCAAATACC).…”

Section: Methodsmentioning

confidence: 99%

“…Although the distribution and frequency of insecticide resistance-conferring mutations in the acetylcholinesterase and voltage gated sodium channel were determined in An. sinensis collected extensively across Guangxi in previous studies [ 11 , 12 ], other questions related to insecticide resistance remain to be answered.…”

Section: Introductionmentioning

confidence: 99%

RDL mutations predict multiple insecticide resistance in Anopheles sinensis in Guangxi, China

Huang

Mei

et al. 2017

Malar J

Self Cite

Background Anopheles sinensis is a major vector of malaria in China. The gamma-aminobutyric acid (GABA)-gated chloride channel, encoded by the RDL (Resistant to dieldrin) gene, is the important target for insecticides of widely varied structures. The use of various insecticides in agriculture and vector control has inevitably led to the development of insecticide resistance, which may reduce the control effectiveness. Therefore, it is important to investigate the presence and distribution frequency of the resistance related mutation(s) in An. sinensis RDL to predict resistance to both the withdrawn cyclodienes (e.g. dieldrin) and currently used insecticides, such as fipronil.MethodsTwo hundred and forty adults of An. sinensis collected from nine locations across Guangxi Zhuang Autonomous Region were used. Two fragments of An. sinensis RDL (AsRDL) gene, covering the putative insecticide resistance related sites, were sequenced respectively. The haplotypes of each individual were reconstructed by the PHASE2.1 software, and confirmed by clone sequencing. The phylogenetic tree was built using maximum-likelihood and Bayesian inference methods. Genealogical relations among different haplotypes were also analysed using Network 5.0.ResultsThe coding region of AsRDL gene was 1674 bp long, encoding a protein of 557 amino acids. AsRDL had 98.0% amino acid identity to that from Anopheles funestus, and shared common structural features of Cys-loop ligand-gated ion channels. Three resistance-related amino acid substitutions (A296S, V327I and T345S) were detected in all the nine populations of An. sinensis in Guangxi, with the 296S mutation being the most abundant (77–100%), followed by 345S (22–47%) and 327I (8–60%). 38 AsRDL haplotypes were identified from 240 individuals at frequencies ranging from 0.2 to 34.8%. Genealogical analysis suggested multiple origins of the 345S mutation in AsRDL.ConclusionsThe near fixation of the 296S mutation and the occurrence of the 327I and 345S mutations in addition to 296S, in all the nine tested An. sinensis populations in Guangxi, strongly indicate a risk of multiple insecticide resistance. The haplotype diversity plus genetic heterogeneities in the geographical distribution, and multiple origins of AsRDL alleles call for a location-customized strategy for monitoring and management of insecticide resistance.