Distribution and corticosteroid regulation of glucocorticoid receptor in the brain of Xenopus laevis

Abstract

Glucocorticoids (GCs) play essential roles in physiology, development, and behavior that are mediated largely by the glucocorticoid receptor (GR). Although the GR has been intensively studied in mammals, very little is known about the GR in nonmammalian tetrapods. We analyzed the distribution and GC regulation of GR in the brain of the frog Xenopus laevis by immunohistochemistry. GR-immunoreactive (GR-ir) cells were widely distributed, with the highest densities in the medial pallium (mp; homolog of the mammalian hippocampus), accumbens, anterior preoptic area (POA; homolog of the mammalian paraventricular nucleus), Purkinje cell layer of the cerebellum, and rostral anterior pituitary gland (location of corticotropes). Lower but distinct GR-ir was observed in the internal granule cell layer of the olfactory bulbs, dorsal and lateral pallium, striatum, various subfields of the amygdala, bed nucleus of the stria terminalis (BNST), optic tectum, various tegmental nuclei, locus coeruleus, raphe nuclei, reticular nuclei, and the nuclei of the trigeminal motor nerves. Treatment with corticosterone (CORT) for 4 days significantly decreased GR-ir in the POA, mp, medial amygdala (MeA), BNST, and rostral pars distalis. Treatment with the corticosteroid synthesis inhibitor metyrapone (MTP) also significantly reduced GR-ir in the POA, mp, MeA and BNST, but not in the rostral pars distalis. Replacement with a low dose of CORT in MTP-treated animals reversed these effects in brain. Thus, chronic increase or decrease in circulating corticosteroids reduces GR-ir in regions of the frog brain. Our results show that the central distribution of GR-ir and regulation by corticosteroids are highly conserved among vertebrates.

Expression and regulation of the Fkbp5 gene in the adult mouse brain

“…Under basal conditions, Fkbp5 mRNA was most strongly expressed in regions also known to express the GR [30,31], such as the hippocampal formation [32,33], the premammillary nucleus [34] or the motor nuclei of the nervus trigeminus and nervus facialis [35]. Intriguingly, in the hypothalamic PVN, a central part of the HPA axis itself and also a mediator of stress response feedback, basal expression of Fkbp5 mRNA was very low.…”

“…An intron-spanning riboprobe for Fkbp5 was designed using Primer3 software, spanning from exon 5 to exon 9 of the murine Fkbp5 gene, with a total length of 491 base pairs (Forward primer 59-39: CTTGGACCACGCTATGGTTT; Reverse primer 59-39: GGATTGACTGCCAACACCTT). In-situ hybridisation using 35 S-UTP-labelled ribonucleotide probes was performed as described previously [28]. Briefly, sections were fixed in 4% paraformaldehyde and acetylated in 0.25% acetic anhydride.…”

“…Afterwards, slides were dehydrated in ascending concentrations of alcohol. On the dried slides, hybridization buffer containing between 1.5 and 2.0610 6 counts per minute of 35 S-UTP -labelled riboprobe was applied with a volume of 100 ml per slide. Brain sections were coverslipped and incubated overnight at 55uC.…”

Elevated stress hormone diminishes the strength of female preferences for acoustic signals in the green treefrog

“…While glucocorticoid receptors are distributed throughout many key auditory processing regions of the anuran brain (i.e., the torus semicircularis, Yao et al, 2008) CORT effects on auditory selectivity remain unknown.…”

XenopusTadpole Tissue Harvest

“…The brain is composed mostly of neurons and glia, but is highly heterogeneous in gene expression (Yao et al 2008;Denver et al 2009). Also, the pituitary is found in a pocket in the ventromedial region of the brain and is not readily separated by accident from the rest of the brain in this procedure.…”