Distinct Roles for CARMIL Isoforms in Cell Migration

Abstract

Molecular mechanisms for cell migration, especially how signaling and cytoskeletal systems are integrated, are not understood well. Here, we examined the role of CARMIL (capping protein, Arp2/3, and Myosin-I linker) family proteins in migrating cells. Vertebrates express three conserved genes for CARMIL, and we examined the functions of the two CARMIL genes expressed in migrating human cultured cells. Both isoforms, CARMIL1 and 2, were necessary for cell migration, but for different reasons. CARMIL1 localized to lamellipodia and macropinosomes, and loss of its function caused loss of lamellipodial actin, along with defects in protrusion, ruffling, and macropinocytosis. CARMIL1-knockdown cells showed loss of activation of Rac1, and CARMIL1 was biochemically associated with the GEF Trio. CARMIL2, in contrast, colocalized with vimentin intermediate filaments, and loss of its function caused a distinctive multipolar phenotype. Loss of CARMIL2 also caused decreased levels of myosin-IIB, which may contribute to the polarity phenotype. Expression of one CARMIL isoform was not able to rescue the knockdown phenotypes of the other. Thus, the two isoforms are both important for cell migration, but they have distinct functions.

Cell Migration and Invadopodia Formation Require a Membrane-binding Domain of CARMIL2

“…First, we examined phenotypes related to cell polarity, lamellipodial dynamics, ruffling, and macropinocytosis (21). To assess cell polarity, phase-contrast movies of sparsely plated cells were collected (Fig.…”

“…HT1080 cells were used for all assays because they are highly motile and express almost exclusively the CARMIL2b isoform used in the rescue experiments. These cells also contain CARMIL1, but lack CARMIL3 (21).…”

“…To deplete endogenous CARMIL2 from cells, we used shRNA in a lentiviral vector, pFLRu-FH-GFP, as described (21). The target sequence was GCAAAGATGGCGAGATCAAG, with the sequence CAGTCGCGTTTGCGACTGG serving as a scrambled non-targeting control.…”

“…Evidence to date, which is not complete, indicates that the three vertebrate isoforms, called CARMIL1, CARMIL2, and CARMIL3, have distinct functions (19,21).…”

“…Loss of CARMIL2 in cultured fibrosarcoma cells (HT1080) leads to loss of macropinocytosis, defective lamellipodial assembly, impaired collective-cell migration, and a distinctive multi-polar phenotype (21,22). Most intriguing, CARMIL2 localizes to vimentin filaments in cells (21).…”