Dissemination of potentially pathogenic bacteria into the environment

Abstract

Under certain conditions, untreated wastewater is released into the sea discharging pathogenic microorganisms into the marine environment. Therefore, it is very important to monitor seawater for the presence of such microorganisms and legislate roles and penalties to avoid and prevent the dumping of such hazardous bacteria. The present study demonstrates the occurrence and survival of pathogenic bacteria in seawater samples collected from four locations at ALSabah beach, Kuwait bay. A total of 230 bacteria were isolated and identified by the amplification of 16S rDNA sequences from bacterial pure cultures. Phylogenetic analyses indicated the dominance of three γ-proteobacteria phylotypes: Enterobacter, Pantoea and Klebseilla. The diversity of the isolated bacteria was examined by restriction fragment length polymorphism (RFLP) analysis of 16S rDNA sequences amplified by a polymerase chain reaction (PCR). In addition, the survival of isolated bacteria in seawater was investigated by monitoring their growth and activity. All isolated bacteria exhibited resistance to penicillin and sulphonamides and demonstrated the potential to survive in seawater for 750 hours. This study exemplified the importance of monitoring seawater that may represent a latent source of hazardous bacteria.

Preliminary Characterization of a Cellulase Producing Bacterial Strain Isolated from a Romanian Hypersaline Lake

“…Bacterial DNA was extracted using the NucleoSpin® Tissue (Macherey-Nagel) kit. 16S rDNA sequence was amplified from extracted DNA using the following primers [27]: 27F (AGAGTTTGATCACTGGCTCAG) and 1492R (ACGGCTTACCTTGTTACGACTT). The reaction was carried out in 25 μl volume, containing: 2.5 μl PCR buffer (Master Mix), 1 mM MgCl 2 , 0.2 mM dNTP, 0.4 μM of each primer, 1.25 U Taq DNA polymerase, 16.8 μl Milli-Q water, 1 μl DNA.…”