Dissemination of Multiple Drug Resistance Genes by Class 1 Integrons in Klebsiella pneumoniae Isolates from Four Countries: a Comparative Study

Abstract

A comparative genetic analysis of 42 clinical Klebsiella pneumoniae isolates, resistant to two or more antibiotics belonging to the broad-spectrum ␤-lactam group, sourced from Sydney, Australia, and three South American countries is presented. The study focuses on the genetic contexts of class 1 integrons, mobilizable genetic elements best known for their role in the rapid evolution of antibiotic resistance among Gram-negative pathogens. It was found that the class 1 integrons in this cohort were located in a number of different genetic contexts with clear regional differences. In Sydney, IS26-associated Tn21-like transposons on IncL/M plasmids contribute greatly to the dispersal of integron-associated multiple-drug-resistant (MDR) loci. In contrast, in the South American countries, Tn1696-like transposons on an IncA/C plasmid(s) appeared to be disseminating a characteristic MDR region. A range of mobile genetic elements is clearly being recruited by clinically important mobile class 1 integrons, and these elements appear to be becoming more common with time. This in turn is driving the evolution of complex and laterally mobile MDR units and may further complicate antibiotic therapy.

Emergence of KPC-producing Klebsiella pneumoniae in Uruguay: infection control and molecular characterization

“…The 100-bp deletion characteristic of Tn 4401 isoform a is indicated above the sequence. Primers used are shown below the sequence: KPCfw, KPCrv 15, 816U, 3098U, 4714 26.…”

Occurrences and Characterization of Antibiotic-Resistant Bacteria and Genetic Determinants of Hospital Wastewater in a Tropical Country

“…In this study, the average level of intI1 genes detected was at least 2 orders of magnitude lower than that detected in hospital wastewaters in China, with tet and sul genes detected in a lower range as well (37). Class 1 integrons are responsible for the spread and carriage of antibiotic resistance gene cassettes in Gram-negative pathogens (38,39). The high concentrations of class 1 integrons detected in raw wastewater and the occurrence in ARB isolates were consistent with recent literature reports, e.g., 97% for E. coli isolates in Iran (40), 76% for E. coli and 43% for Salmonella isolates in Netherlands (41), 67% for E. coli isolates in Spain (42), and 63% for E. coli isolates in Thailand (43).…”

Integrons in uropathogenic Escherichia coli and their relationship with phylogeny and virulence

“…The presence of class 1 and 2 integrons was analyzed using primers designed to detect the corresponding integrase genes: HS463a and HS464 for intI1 [16], and HS501 and HS502 for intI2 [17]. In the subset of isolates that were positive for intI1, the Pc promoter region was amplified using primers Pre-Pc (5 0 GATGCGTGGAGACCGAAACCTT3 0 ) and Post-Pc (5 0 GCGACTGCCCTGCTGCGTAACAT 3 0 ).…”