Disparate molecular evolution of two types of repetitive DNAs in the genome of the grasshopper Eyprepocnemis plorans

Abstract

Wide arrays of repetitive DNA sequences form an important part of eukaryotic genomes. These repeats appear to evolve as coherent families, where repeats within a family are more similar to each other than to other orthologous representatives in related species. The continuous homogenization of repeats, through selective and non-selective processes, is termed concerted evolution. Ascertaining the level of variation between repeats is crucial to determining which evolutionary model best explains the homogenization observed for these sequences. Here, for the grasshopper Eyprepocnemis plorans, we present the analysis of intragenomic diversity for two repetitive DNA sequences (a satellite DNA (satDNA) and the 45S rDNA) resulting from the independent microdissection of several chromosomes. Our results show different homogenization patterns for these two kinds of paralogous DNA sequences, with a high between-chromosome structure for rDNA but no structure at all for the satDNA. This difference is puzzling, considering the adjacent localization of the two repetitive DNAs on paracentromeric regions in most chromosomes. The disparate homogenization patterns detected for these two repetitive DNA sequences suggest that several processes participate in the concerted evolution in E. plorans, and that these mechanisms might not work as genome-wide processes but rather as sequence-specific ones.

B chromosomes showing active ribosomal RNA genes contribute insignificant amounts of rRNA in the grasshopper Eyprepocnemis plorans

“…Teruel et al (2007) later showed that this was not a unique case, by finding recurrent B-NOR activity in the Torrox (Málaga, Spain) population, a fact that has been corroborated by detecting B-specific ITS2 rDNA transcripts (Ruiz-Estévez et al 2012), based on a characteristic adenine insertion found only in ITS2 sequences obtained from microdissected B chromosomes (Teruel 2009;Teruel et al 2014). The fact that 16 out of the 17 ITS2 sequences obtained from the B chromosome showed the adenine insertion, but none of the 35 sequences from microdissected A chromosomes (or from 0B genomic DNA) carried it, indicates that this adenine is exclusive of the B chromosome and is present in the immense majority of the rDNA units located in the B chromosome (Teruel et al 2014). More recently, we have shown that B chromosomes from other Spanish populations also display B-NOR activity but at rates lower than that observed in Torrox (Ruiz-Estévez et al 2013).…”

“…This could be achieved by designing, with the Primer 3 v.0.4.0 software, a single forward (F: 5′ ACTTGGGAGCGTCGTGGTA 3′) and two reverse primers, one of them anchoring in the three adenine residues specific to B chromosomes (Teruel 2009;Ruiz-Estévez et al 2012;Teruel et al 2014) (R1: 5′ CGTTGTACGAAAGAGTTTGAG 3′) and the other (R2: 5′ AGGTCGTTGTACGAAAGAGTT 3′) finishing its anchoring in the second of these three adenines (Fig. 1).…”

“…1 Sequence of the primers employed to amplify the ITS2 B and the ITS2 A+B amplicons. The forward (F) primer was common but the two reverse (R1 and R2) primers were anchored in the same region but whereas R1 was anchored in the three adenine residues being exclusive of the B chromosome rDNA (Teruel 2009;Teruel et al 2014), the R2 one finished with two of these adenine residues, so that it could amplify the ITS2 region from both A and B chromosomes Bioline), 0.7 µM of each forward and reverse primer and 5 ng cDNA, in a final volume of 15 µl. We performed two types of qPCR due to the need to use different PCR conditions for HKG and ITS2 amplification, since the latter required fine tuning of the reverse primer and high melting temperature to avoid unspecific amplification.…”

B Chromosomes in the Grasshopper <b><i>Eyprepocnemis plorans</i></b> Are Present in All Body Parts Analyzed and Show Extensive Variation for rDNA Copy Number

“…We analyzed DNA sequences with the Bioedit software version 7.1.3.0 [Hall, 1999] and used BLAST (Basic Local Alignment Search tool) at the NCBI site to search for sequence homology with the sequences reported by Muñoz-Pajares et al [2011] (accession No. : FR681612) and Teruel et al [2014] (accession Nos: JN811827-JN811902).…”

“…These were a SCAR (sequence-characterized amplified region) marker, constituting a part of the external spacer of the 45S rDNA [Muñoz-Pajares et al, 2011], and an adenine insertion in the ITS2 region of the rDNA from the B chromosomes (ITS2_B marker) [Ruiz-Estévez et al, 2012;Teruel et al, 2014]. These molecular markers allowed us to test the 2 following questions: (1) Are B chromosomes present in all body parts?, and (2) is the B chromosome composition similar in all males from the same population, so that the number of rDNA units in an individual could serve to infer the number of Bs it carries?…”