Discovery of single nucleotide polymorphism in Capsicum and SNP markers for cultivar identification

Abstract

Molecular markers based on single nucleotide polymorphisms (SNPs) are abundant and evenly distributed in a whole genome enough to distinguish individuals in a population. In recent years, sets of SNP markers have been designed and applied for cultivar identification in various crop species. This paper is the first to report the development of a panel of SNP markers for variety identification in peppers. We used conserved ortholog set II (COSII) markers developed from conserved unigenes between tomato and Arabidopsis to identify SNPs in peppers. We tested 438 COSII primer sets amplified as single PCR products out of a total 600 COSII primer sets. Among the 438 COSII primers, 170 primer sets (38.8%) showed polymorphisms between Capsicum annuum 'RNaky (RN)'and C. chinense 'PI 159234 (234)'. In contrast, only 48 primer sets (11.0%) out of 438 primers sets were polymorphic between C. annuum 'Perennial (PER), and 'Dempsey (DEMP)'. The average frequency of SNPs plus InDels between C. annuum and C. chinense was 1/189 bp and between C. annuum spp. was 1/948 bp. Primer sets showing SNP between C. annuum PER and DEMP were re-designed to Allele Specific PCR (AS-PCR) primers and we finally selected a total of 40 SNP markers for cultivar identification. As the result, we were able to discriminate 97.5% of the 81 commercial hot cultivars and 100% of the 17 sweet pepper cultivars. We conclude the paper by discussing the use of the SNP marker set for cultivar identification and other applications.

Development of a SNP-based CAPS assay for the Me1 gene conferring resistance to root knot nematode in pepper

“…AZN-1 and C. annuum cv. PM217 using the primers: P-F: AAGGTGTCTCCCTCAGAATT-CAG, P-R: ATCTGTCCCATTGCCTTTGTAAC (Jung et al 2010). PCR reaction mixtures and thermal cycling conditions were the same as described above for the SSR fragment amplifications.…”

Quantitative trait loci from the host genetic background modulate the durability of a resistance gene: a rational basis for sustainable resistance breeding in plants

“…It was genotyped with 236 molecular markers: 108 SNPs (Nicolaï et al, 2012), 29 SNPs (Jung et al, 2010), 47 simple sequence repeats (Lee et al, 2004;Minamiyama et al, 2006;Nagy et al, 2007), 33 amplified fragment-length polymorphisms (Lefebvre et al, 2002), one single-strand conformation polymorphism (SSCP-PM5, Fazari et al, 2012), two known genes and 16 new markers (Supplementary Table I) corresponding to previously mapped restriction fragment length polymorphisms and/or conserved ortholog set (COS II) sequences and designed using the Sol Genomics network (www.solgenomics.net). The two known genes were pvr2 (the major resistance locus to PVY) genotyped using the tetra-ARMS marker as in Rubio et al (2008), and pvr6 coding for the eIF(iso)4E (eukaryotic initiation factor iso4E) protein genotyped with a new marker targeting a 82-nucleotide deletion differentiating alleles pvr6 þ and pvr6 (Ruffel et al, 2006;Supplementary data I).…”

Study of Commercially Available Lobelia chinensis Products Using Bar-HRM Technology

“…HRM technology has been utilized for discriminating cultivated varieties, medicinal plant species, herbal tea, wine authenticity (Jung et al, 2010; Osathanunkul et al, 2015, 2016; Costa et al, 2016; Li et al, 2016; Song et al, 2016; Pereira et al, 2017). However, a reliable HRM approach to identify herbal medicines on Chinese herb market is still lacks.…”