Discovery of imidazole-based GSK-3β inhibitors for transdifferentiation of human mesenchymal stem cells to neurons: A potential single-molecule neurotherapeutic foresight

Abstract

The transdifferentiation of human mesenchymal stem cells (hMSC) to functional neurons is crucial for the development of future neuro-regenerative therapeutics. Currently, transdifferentiation of hMSCs to neurons requires a “chemical cocktail” along with neural growth factors. The role of the individual molecules present in a “chemical cocktail” is poorly understood and may cause unwanted toxicity or adverse effects. Toward, this goal, we have showcased the discovery of an imidazole-based “single-molecule” transdifferentiation initiator SG-145C. This discovery was achieved via screening of a small molecule library through extensive in silico studies to shortlist the best-fitting molecules. This discovery evolved through a careful selection to target Glycogen synthase kinase-3β (GSK-3β), which is one of the important proteins responsible for neurogenesis. Rigorous computational experiments, as well as extensive biological assays, confirmed that SG-145C has significant potential to transdifferentiate hMSCs to neurons. Interestingly, our results suggest that SG-145C can inhibit the proteasomal degradation of phosphorylated β-catenin, in turn promoting transdifferentiation of hMSCs into neurons via the Wnt pathway.

Discovery of Quinazoline and Quinoline-Based Small Molecules as Utrophin Upregulators via AhR Antagonism for the Treatment of Duchenne Muscular Dystrophy

“…Subsequently, 300 ng of the total RNA was utilized to synthesize cDNA employing the RevertAid First Strand cDNA Synthesis Kit, following the manufacturer’s protocols. For quantitative polymerase chain reaction (qPCR), a BioRad CFX96 Real-Time System was employed, utilizing the BioRad iTaqTM Universal SYBR Green Supermix for the amplification reaction . Utrophin amplification and normalization against the housekeeping gene GAPDH were conducted in triplicate ( n = 3).…”

“…After undergoing three washes with 1× TBS-T, the membrane was subjected to incubation with an HRP-conjugated antimouse secondary antibody (diluted 1:5000) for 2 h at room temperature. Subsequently, the membrane was washed with 1× TBS-T buffer, and protein detection was executed through chemiluminescence using immobilon Forte Western HRP substrate in a BioRad ChemiDoc system . Densitometric analysis of the acquired images was performed using ImageJ software with GAPDH utilized as the loading control.…”

“…For quantitative polymerase chain reaction (qPCR), a BioRad CFX96 Real-Time System was employed, utilizing the BioRad iTaqTM Universal SYBR Green Supermix for the amplification reaction. 39 Utrophin amplification and normalization against the housekeeping gene GAPDH were conducted in triplicate (n = 3). The following primer pairs were employed: for Utrophin (Mouse), forward 5′ AGAGCACTATGACCCCTCCC 3′ and reverse 5′ CATCTGGGCCAGTCGTGTAG 3′, and for GAPDH (Mouse), forward 5′ CTTCGGGCCACGCTAATCTC 3′ and reverse 5′ CCAATACGGCCAAATCCGTTC 3′.…”

“…Subsequently, the membrane was washed with 1× TBS-T buffer, and protein detection was executed through chemiluminescence using immobilon Forte Western HRP substrate in a BioRad ChemiDoc system. 39 Densitometric analysis of the acquired images was performed using ImageJ software with GAPDH utilized as the loading control.…”

Ratiometric Fluorescent Probe Promotes Trans-differentiation of Human Mesenchymal Stem Cells to Neurons

“…MSCs are versatile pluripotent stem cells that have recently been investigated as a preventive and curative measure for a wide range of neurodegenerative diseases. − Utilizing MSCs , over other cells has a number of benefits, including quick accessibility, a noninvasive collection method, a limited immunogenic potential, and a greater capability of differentiation. Even though stem cell therapy has a lot of potential for treating neuro-degeneration, it has some drawbacks, such as lower differentiation rates or unexpected differentiation in in vivo surroundings .…”