Discovery of Human-Similar Gene Fusions in Canine Cancers

Ulvé, Ronan; Rault, Mélanie; Bahin, Mathieu; Lagoutte, Laëtitia; Abadie, Jérôme; Brito, Clotilde De; Coindre, Jean‐Michel; Botherel, Nadine; Rousseau, Audrey; Wucher, Valentin; Cadieu, Édouard; Thiéblemont, Catherine; Hitte, Christophe; Cornevin, Laurence; Cabillic, Florian; Bachelot, Laura; Gilot, David; Hennuy, Benoît; Guillaudeux, Thierry; Goff, Arnaud Le; Derrien, Thomas; Hédan, Benoît; André, Catherine

doi:10.1158/0008-5472.can-16-2691

Cited by 22 publications

(31 citation statements)

References 19 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Clustering of lymphoma in related dogs has been reported, suggesting an inherited predisposition . Genetic and epigenetic changes have been identified in canine lymphoma, but the studies generally have been across multiple breeds . Studies within a breed have identified germline changes across tumor types, potentially supporting a breed‐associated cancer risk that is not specific for lymphoma …”

Section: Discussionmentioning

confidence: 99%

Demographic risk factors for lymphoma in Australian dogs: 6201 cases

Bennett

Taylor

Williamson

2018

Veterinary Internal Medicne

View full text Add to dashboard Cite

BackgroundLymphoma is common in the dog. Studies of population risk factors primarily have been derived from referral institution or insurance data.ObjectiveTo identify and quantify the host risk factors for lymphoma in a broad population of Australian dogs.AnimalsData on 6201 client owned dogs were retrieved from a commercial veterinary laboratory, a general practice group and 2 referral hospitals.MethodsData collected included breed, sex, and neuter status. A reference population of 640 105 dogs was generated from the referral hospitals and from council registration data. The risk of lymphoma by sex and neuter status was calculated as odds ratios (OR).ResultsThe study identified 30 breeds at increased risk of lymphoma, 15 that have not been reported previously, and 26 breeds at decreased risk, 18 that have not been reported previously. Males were over represented compared to females with an OR of 1.1 (95% CI, 1.1–1.2; P < .001). Neutered animals were at higher risk compared to intact animals with an OR of 3.2 (95% CI, 2.9–3.5) which was found in both males (OR, 2.8; 95% CI; 2.5–3.2) and females (OR, 4.4; 95% CI, 3.5–5.1).Conclusions and Clinical ImportanceBreed, sex, and neuter status alter the risk of lymphoma in dogs. These 3 factors must be considered when evaluating lymphoma risk as potential markers of underlying differences in disease etiology. Comparison of breeds at increased and decreased risk could be advantageous when evaluating specific etiological factors.

show abstract

Section: Discussionmentioning

confidence: 99%

Demographic risk factors for lymphoma in Australian dogs: 6201 cases

Bennett

Taylor

Williamson

2018

Veterinary Internal Medicne

View full text Add to dashboard Cite

show abstract

“…All cell lines were tested for mycoplasma with MycoAlertTM Plus kit (Lonza, Rockland, ME) and were mycoplasma-free cells. The SNVs of CFA5 and CFA2 were sequenced by Sanger sequencing as previously described 10 with the following primers: CFA2_29716535-F : GGTGTACTTTCGGGTCCAAC, CFA2_29716535-R :CCCTGTCATTCGATGTCCTT, CFA5_30489203-30489217_F :…”

Section: Methylation Analysesmentioning

confidence: 99%

“…Over the past decade, the Dog has arisen as a relevant and under used spontaneous model for the analysis of cancer predisposition and progression, as well as development and trials of more efficient therapies for a number of human cancers [1][2][3][4][5][6][7][8][9][10] . With over 4.2 million dogs diagnosed with cancer annually in USA 8 , canine cancers represent a unique source of spontaneous tumors.…”

Section: Introductionmentioning

confidence: 99%

The tree that hides the forest: identification of common predisposing loci in several hematopoietic cancers and several dog breeds

Hédan¹,

Cadieu²,

Rimbault³

et al. 2020

Preprint

Self Cite

View full text Add to dashboard Cite

Histiocytic sarcoma (HS) is a rare but aggressive cancer in humans and dogs. The spontaneous canine model, with the clinical, epidemiological and histological similarities with human HS and specific breed predispositions, is a unique model/opportunity to unravel the genetic bases of this cancer. In this study, we aimed to identify germline risk factors associated with the development of HS in canine predisposed breeds. We used a methodology that combined several genome-wide association studies in a multi-breed and multi-cancer approach, as well as targeted next generation sequencing, and imputation combining several breeds (Bernese mountain dog, Rottweiler, flat coated retriever and golden retriever) and three haematopoietic cancers (HS, lymphoma and mast cell tumor). Results showed that we not only refined the previously identified HS risk CDKN2A locus but we identified new loci on canine chromosomes 2, 5, 12, 14, 20, 26 and X. Capture and targeted sequencing of specific loci pointed towards the existence of regulatory variants in non coding regions and/or methylation mechanisms linked to risk haplotypes, leading to strong cancer predispositions in specific dog breeds. Our results showed that these canine cancer predisposing loci appear to be due to the additive effect of several risk haplotype involved also in other haematopoietic cancers such lymphoma or mast cell tumor, illustrating the pleiotropic nature of these canine cancer loci as observed in human oncology, thus reinforcing the interest of predisposed dog breeds to study cancer initiation and progression.

show abstract

“…In humans, dermatofibrosarcoma protuberans (DFSP), is characterized by the pathognomonic COL3A1-PDGFβ fusion and a corresponding oncogenic gene fusion with identical chromosomal breakpoints has been documented in a DFSP-like tumour in a dog. 22 As genetic evaluation of tumours accelerates and molecular technologies become more affordable and available, it is likely that genetic profiling will be used increasingly for diagnostic and prognostic purposes in veterinary oncology. By applying sophisticated molecular techniques to veterinary sarcoma patients, it is likely that we will be able to more comprehensively classify canine and feline sarcomas, understand their molecular drivers, identify potential therapeutic targets and discover novel prognostic biomarkers.…”

Section: Overview Of Sarcomasmentioning

confidence: 99%

Sarcomas—A barren immunological wasteland or field of opportunity for immunotherapy?

Atherton

Lenz

Mason

2020

Vet Comparative Oncology

View full text Add to dashboard Cite

Key advances in our understanding of immunobiology and the immunosuppressive mechanisms of the tumour microenvironment have led to significant breakthroughs in manipulating the immune system to successfully treat cancer. Remarkable therapeutic responses have occurred with tumours that carry a high mutational burden. In these cases, pre-existing tumour-specific T cells can be rejuvenated via checkpoint inhibition to eliminate tumours. Furthermore, durable remissions have been achieved in haematological malignancies following adoptive transfer of T cells that specifically target cell surface proteins where expression is restricted to the malignancy's cell of origin. Soft tissue sarcomas and bone sarcomas have a paucity of non-synonymous somatic mutations and do not commonly express known, targetable, tumour-specific antigens. Historically, soft tissue sarcomas have been considered immunologically 'cold' and as such, unlikely candidates for immune therapy. Here, we review the immune landscape of canine and feline sarcomas and the immunotherapeutic strategies that have been employed in veterinary clinical trials to improve patient outcome. We also provide insight into immunotherapeutic approaches being used to treat human sarcomas. Together, current data indicates that, rather than a barren immunological wasteland, sarcomas represent a field of opportunities for immunotherapies. Furthermore, we and others would suggest that strategic combinations of immunotherapeutic approaches may hold promise for more effective treatments for high grade soft tissue sarcomas and bone sarcomas.

show abstract

Discovery of Human-Similar Gene Fusions in Canine Cancers

Cited by 22 publications

References 19 publications

Demographic risk factors for lymphoma in Australian dogs: 6201 cases

Demographic risk factors for lymphoma in Australian dogs: 6201 cases

The tree that hides the forest: identification of common predisposing loci in several hematopoietic cancers and several dog breeds

Sarcomas—A barren immunological wasteland or field of opportunity for immunotherapy?

Contact Info

Product

Resources

About