Discovery of a Potent, Direct Thrombin Inhibiting Aptamer

Wagner-Whyte, J.; Khuri, Shukri F.; Preiss, J.R.; Kurz, Julia; Olson, Kenneth R.; Hatala, Paul; Boomer, Ryan M.; Fraone, Joseph; Brosnan, N.; Makim, A.; Lewis, Sidney D.; Cai, Lei; McCauley, Thomas G.; Hutabarat, Renta; Horváth, Cs.; Funk, Walter D.; Deitcher, Steven R.; Thatte, Hemant S.; Hussaini, B.; Treanor, P.; Rottman, James B.; Diener, John L

doi:10.1111/j.1538-7836.2007.tb00166.x

Cited by 11 publications

(9 citation statements)

References 0 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…A second—reciprocal—scale is given that shows how much thrombin remained active. The sequence of the aptamer NU172 (used in this study for comparison reasons) is CGCCTAGGTTGGGTAGGGTGGTGGCG (20). (ab = abasic site, C3 = n-propyl spacer nucleotide, TriEG = triethylene glycol nucleotide, TetEG = tetraethylene glycol nucleotide).…”

Section: Resultsmentioning

confidence: 99%

“…Exchanging the nucleoside linkers on the 3′-end for abasic sites (aptamer 15 with a phosphate on the 3′-end due to synthesis reasons) resulted in the most potent aptamer in the entire study and a 1.5-fold increase of activity compared to HD1 was observed. Therefore, aptamer 15 is superior to a different anti-thrombin aptamer that also targets exosite I and that is currently in phase II clinical trials, namely NU172 ( Figure 2 ) ( 20 ). This different behavior of opposed terminal extensions of HD1 was especially surprising to us since in the co-crystal structure of the HD1– thrombin complex the 5′- and the 3′-ends reside right next to each other ( Figure 1 a).…”

Section: Resultsmentioning

confidence: 99%

“…Previous studies already pointed toward this direction for aptamer HD1 but did not investigate this in greater detail ( 25 , 26 ). Thus, the data presented here provide a comprehensive view on aptamer dependence on opposed terminal extensions and give rise to variants that were 1.5-fold more active as the parental aptamer ( HD1 ) and even more active as a second generation exosite I targeting aptamer ( NU172 ) currently under investigation in clinical trials ( 20 ). As a further result, we present now caged HD1 derivatives that are light-responsive and that before irradiation are more active than HD1 and after irradiation are cleanly turned OFF and do not show any interaction with thrombin anymore.…”

Section: Resultsmentioning

confidence: 99%

See 2 more Smart Citations

Dependence of aptamer activity on opposed terminal extensions: improvement of light-regulation efficiency

Buff¹,

Schäfer²,

Wulffen³

et al. 2009

Nucleic Acids Research

View full text Add to dashboard Cite

Aptamers that can be regulated with light allow precise control of protein activity in space and time and hence of biological function in general. In a previous study, we showed that the activity of the thrombin-binding aptamer HD1 can be turned off by irradiation using a light activatable ‘caged’ intramolecular antisense-domain. However, the activity of the presented aptamer in its ON state was only mediocre. Here we studied the nature of this loss in activity in detail and found that switching from 5′- to 3′-extensions affords aptamers that are even more potent than the unmodified HD1. In particular we arrived at derivatives that are now more active than the aptamer NU172 that is currently in phase 2 clinical trials as an anticoagulant. As a result, we present light-regulatable aptamers with a superior activity in their ON state and an almost digital ON/OFF behavior upon irradiation.

show abstract

Section: Resultsmentioning

confidence: 99%

Section: Resultsmentioning

confidence: 99%

Section: Resultsmentioning

confidence: 99%

See 1 more Smart Citation

Dependence of aptamer activity on opposed terminal extensions: improvement of light-regulation efficiency

Buff¹,

Schäfer²,

Wulffen³

et al. 2009

Nucleic Acids Research

View full text Add to dashboard Cite

show abstract

“…The E100300 to target platelet derived growth factor (PDGF) (phase II) ( JO et al ., 2006 ). The Nu172 to target thrombin; phase II ( Wagner-Whyte et al ., 2007 ), REG1, which targets factor IXa; phase IIb ( Becker, 2009 ), ARC 1779, which inhibits the acute coronary syndromes by preventing the binding of platelet receptor glycoprotein Ib to its receptor; phase I/II ( ClinicalTrials.gov, 2009 ), AS1411, which is being used to treat cancer by inhibiting their DNA replication; phase III ( Stuart et al ., 2009 ), ARC1905, which prevents age-related macular degeneration (AMD); phase I ( ClinicalTrials.gov, 2010 ), LY2181308, which is used in treatment of nonsmall cell lung cancer (NSLC); phase III ( Cancerhelp.org.uk, 2010 ), and many others. However, macugen was the first aptamer to get the FDA approval in 2004 for treatment of wet AMD ( NG et al ., 2006 ).…”

Section: Mechanisms and Strategies Of Delivery Of Chimerasmentioning

confidence: 99%

Chimeric aptamers in cancer cell-targeted drug delivery

Kanwar

Roy

Kanwar

2011

Critical Reviews in Biochemistry and Molecular Biology

123

View full text Add to dashboard Cite

Aptamers are single-stranded structured oligonucleotides (DNA or RNA) that can bind to a wide range of targets ("apatopes") with high affinity and specificity. These nucleic acid ligands, generated from pools of random-sequence by an in vitro selection process referred to as systematic evolution of ligands by exponential enrichment (SELEX), have now been identified as excellent tools for chemical biology, therapeutic delivery, diagnosis, research, and monitoring therapy in real-time imaging. Today, aptamers represent an interesting class of modern Pharmaceuticals which with their low immunogenic potential mimic extend many of the properties of monoclonal antibodies in diagnostics, research, and therapeutics. More recently, chimeric aptamer approach employing many different possible types of chimerization strategies has generated more stable and efficient chimeric aptamers with aptamer-aptamer, aptamer-nonaptamer biomacromolecules (siRNAs, proteins) and aptamer-nanoparticle chimeras. These chimeric aptamers when conjugated with various biomacromolecules like locked nucleic acid (LNA) to potentiate their stability, biodistribution, and targeting efficiency, have facilitated the accurate targeting in preclinical trials. We developed LNA-aptamer (anti-nucleolin and EpCAM) complexes which were loaded in iron-saturated bovine lactofeerin (Fe-blf)-coated dopamine modified surface of superparamagnetic iron oxide (Fe3O4) nanoparticles (SPIONs). This complex was used to deliver the specific aptamers in tumor cells in a co-culture model of normal and cancer cells. This review focuses on the chimeric aptamers, currently in development that are likely to find future practical applications in concert with other therapeutic molecules and modalities.

show abstract

“…NU172 (ARCA biopharma &Nuvelo) is a direct antithrombin DNA aptamer (term derived from the Latin ‘ aptus ’, to fit; a protein-binding oligonucleotide) [Wagner-Whyte et al . 2007].…”

Section: Direct Thrombin Inhibitorsmentioning

confidence: 99%

New parenteral anticoagulants in development

Gómez-Outes

Suárez-Gea

Lecumberri

et al. 2010

Therapeutic Advances in Cardiovascular Disease

View full text Add to dashboard Cite

The therapeutic armamentarium of parenteral anticoagulants available to clinicians is mainly composed by unfractionated heparin (UFH), low-molecular-weight heparin (LMWH), fondaparinux, recombinant hirudins (i.e. bivalirudin, desirudin, lepirudin) and argatroban. These drugs are effective and safe for prevention and/or treatment of thromboembolic diseases but they have some drawbacks. Among other inconveniences, UFH requires regular anticoagulant monitoring as a result of variability in the anticoagulant response and there is a risk of serious heparin-induced thrombocytopaenia (HIT). LMWH, fondaparinux and recombinant hirudins are mainly cleared through the kidneys and their use in patients with severe renal insufficiency may be problematic. LMWH is only partially neutralized by protamine while fondaparinux and recombinant hirudins have no specific antidote. Novel anticoagulants in development for parenteral administration include new indirect activated factor Xa (FXa) inhibitors (idrabiotaparinux, ultra-low-molecular-weight heparins [semuloparin, RO-14], new LMWH [M118]), direct FXa inhibitors (otamixaban), direct FIIa inhibitors (flovagatran sodium, pegmusirudin, NU172, HD1-22), direct FXIa inhibitors (BMS-262084, antisense oligonucleotides targeting FXIa, clavatadine), direct FIXa inhibitors (RB-006), FVIIIa inhibitors (TB-402), FVIIa/tissue factor inhibitors (tifacogin, NAPc2, PCI-27483, BMS-593214), FVa inhibitors (drotrecogin alpha activated, ART-123) and dual thrombin/FXa inhibitors (EP217609, tanogitran). These new compounds have the potential to complement established parenteral anticoagulants. In the present review, we discuss the pharmacology of new parenteral anticoagulants, the results of clinical studies, the newly planned or ongoing clinical trials with these compounds, and their potential advantages and drawbacks over existing therapies.

show abstract

Discovery of a Potent, Direct Thrombin Inhibiting Aptamer

Cited by 11 publications

References 0 publications

Dependence of aptamer activity on opposed terminal extensions: improvement of light-regulation efficiency

Dependence of aptamer activity on opposed terminal extensions: improvement of light-regulation efficiency

Chimeric aptamers in cancer cell-targeted drug delivery

New parenteral anticoagulants in development

Contact Info

Product

Resources

About