Directed mutation of the basic domain of v-Jun alters DNA binding specificity and abolishes its oncogenic activity in chicken embryo fibroblasts

Jun, the oncoprotein

“…Despite this variation in targeting, there appears to be a common core of genes that need to be addressed to e ect oncogenic transformation. Mutations in the Jun DNA binding domain that eliminate interaction with the TRE lead to a complete loss of oncogenicity; mutations that preserve TRE recognition may cause a reduction in oncogenicity (Basso et al, 2000). Although the basic information of DNA recognition is encoded in the structure of the DNA binding domain, it is important to remember that this is a dimeric structure and that di erent dimerization partners can signi®cantly modulate the speci®city of DNA targeting .…”

Transcriptional upregulation of SPARC, in response to c-Jun overexpression, contributes to increased motility and invasion of MCF7 breast cancer cells

“…The purified product was digested with XhoI and HindIII restriction enzymes and subsequently ligated into a similarly digested pGL2-Basic vector resulting in SPARC promoter 770/+28-pGL2-Basic. Two-step PCR (Basso et al, 2000) was used to generate point mutations within the SPARC promoter AP-1 'like' site at 71051/71045. The pGL2-Basic forward primer 5'tgtatcttatggtactgtaactg3' designated (A1) corresponds to a region of the pGL2-Basic vector which is upstream of the vectors SmaI site.…”

v-Jun downregulates the SPARC target gene by binding to the proximal promoter indirectly through Sp1/3

“…Interestingly, v-Jun/cebp has been shown to heterodimerize with avian Jun and Fos to generate heterodimers that bind both to an AP1 and a c/EBP motif in vitro (Basso et al, 2000) and this might also happen with Drosophila Jun and Fos (Kockel et al, 2001). In fact, to eliminate this possibility, a v-Jun/cebp-derivative, designated v-Jun/cebp/glz (Basso et al, 2000), was used in which the natural dimerization domain of v-Jun was replaced by the homodimerization domain of GCN4 (glz for GCN4 leucine zipper). This transcription factor is another member of b-zip family isolated in yeast that binds DNA strictly as a homodimer and cannot form stable dimers with any known Jun and Fos proteins (Hughes et al, 1992;Oliviero et al, 1992;Castellazzi et al, 1993).…”

“…To this aim, we took advantage of a v-Jun-derivative, 0 -TGACT-CA) (Johnson, 1993;Suckow et al, 1993). Interestingly, v-Jun/cebp has been shown to heterodimerize with avian Jun and Fos to generate heterodimers that bind both to an AP1 and a c/EBP motif in vitro (Basso et al, 2000) and this might also happen with Drosophila Jun and Fos (Kockel et al, 2001). In fact, to eliminate this possibility, a v-Jun/cebp-derivative, designated v-Jun/cebp/glz (Basso et al, 2000), was used in which the natural dimerization domain of v-Jun was replaced by the homodimerization domain of GCN4 (glz for GCN4 leucine zipper).…”

“…Studies from several laboratories led to the characterization of candidate targets in avian cells (Basso et al, 2000;Bader et al, 2001) as well as in murine (Mettouchi et al, 1994;Fu et al, 2000) and human (Rinehart-Kim et al, 2000) cells. Although different techniques were used for screening, the same statistics was observed, that is, 2/3 of the genes are activated by Jun and 1/3 are repressed.…”