Direct sequencing of double-stranded polymerase chain reaction-amplified 16S rDNA

Both, Beatrix; Krupp, Guido; Stackebrandt, Erko

doi:10.1016/0003-2697(91)90092-8

Cited by 24 publications

(15 citation statements)

References 7 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The 16S rRNA gene was amplified according to Both et al . The set of primers used in this experiment were 5′‐AGAGTTTGATCCTGGCTCAGAACGAACGCT‐3′ (positions 8–37) and 5′‐TACGGCTACCTTGTTACGACTTCACCCC‐3′ (positions 1479–1506) according to the Escherichia coli numbering system.…”

Section: Methodsmentioning

confidence: 99%

Hepatoprotective effects of kombucha tea: identification of functional strains and quantification of functional components

Yong

et al. 2013

J. Sci. Food Agric.

View full text Add to dashboard Cite

show abstract

Section: Methodsmentioning

confidence: 99%

Hepatoprotective effects of kombucha tea: identification of functional strains and quantification of functional components

Yong

et al. 2013

J. Sci. Food Agric.

View full text Add to dashboard Cite

show abstract

“…intergenic spacer region PCR was performed as described by Both et al [13]. Primers used for amplification of the spacer region were Al 6 : 5'-TTGCATGGATCCTGCGG-CTGGATCACCTCC-3' and B23 : 5'-GAATCAG-GATCCGAATGCCCTTATCGCGCTC-3'.…”

Section: In Vitro Ampkjication and Cloning Of The 16s-23smentioning

confidence: 99%

16S-23S ribosomal RNA spacer regions of Acetobacter europaeus and A. xylinum, tRNA genes and antitermination sequences

Sievers

1996

FEMS Microbiology Letters

View full text Add to dashboard Cite

The 16S-23S ribosomal RNA spacer regions of Acetobacter europaeus DSM 6160, A. xylinum NCIB 11664 and A. xylinum CL27 were amplified by PCR. Specific PCR products were obtained from each strain and their nucleotide sequences determined. The spacer region of A. europaeus comprises 768 nucleotides (nt), that of A. xylinum 778 nt and that of A. xylinum CL27 759 nt. Genes encoding tRNAIle and tRNAAla were identified. Putative antitermination sequences were found between the tRNAAla sequence and the 5'-terminus of the 23S rRNA coding sequence. The boxA element has the nucleotide sequence TGCTCTTTGATA. Based on hybridization data of digested chromosomal DNA with spacer-specific probes, the copy number of the rrn operons on the chromosome of Acetobacter strains is estimated to be four.

show abstract

“…16S ribosomal DNA (rDNA) was amplified in vitro (PCR) by using the method of Both et al (1) in combination with oligonucleotide primers complementary to highly conserved regions of bacterial rRNA genes. The 5Ј-and 3Ј-terminal primers used were GAGTTTGAT(C/T)(C/A)TGGCTCA (positions 9 to 26, according to the E. coli numbering system [2]) and CA(G/T)AAAGGAGGTGATCC (positions 1545 to 1529), respectively (11).…”

mentioning

confidence: 99%

Characterization of Acetic Acid Bacteria in Traditional Acetic Acid Fermentation of Rice Vinegar (Komesu) and Unpolished Rice Vinegar (Kurosu) Produced in Japan

Nanda¹,

Taniguchi²,

Ujike³

et al. 2001

Appl Environ Microbiol

150

View full text Add to dashboard Cite

Bacterial strains were isolated from samples of Japanese rice vinegar (komesu) and unpolished rice vinegar (kurosu) fermented by the traditional static method. Fermentations have never been inoculated with a pure culture since they were started in 1907. A total of 178 isolates were divided into groups A and B on the basis of enterobacterial repetitive intergenic consensus-PCR and random amplified polymorphic DNA fingerprinting analyses. The 16S ribosomal DNA sequences of strains belonging to each group showed similarities of more than 99% with Acetobacter pasteurianus. Group A strains overwhelmingly dominated all stages of fermentation of both types of vinegar. Our results indicate that appropriate strains of acetic acid bacteria have spontaneously established almost pure cultures during nearly a century of komesu and kurosu fermentation.

show abstract

Direct sequencing of double-stranded polymerase chain reaction-amplified 16S rDNA

Cited by 24 publications

References 7 publications

Hepatoprotective effects of kombucha tea: identification of functional strains and quantification of functional components

Hepatoprotective effects of kombucha tea: identification of functional strains and quantification of functional components

16S-23S ribosomal RNA spacer regions of Acetobacter europaeus and A. xylinum, tRNA genes and antitermination sequences

Characterization of Acetic Acid Bacteria in Traditional Acetic Acid Fermentation of Rice Vinegar (Komesu) and Unpolished Rice Vinegar (Kurosu) Produced in Japan

Contact Info

Product

Resources

About