Direct detection of nucleic acid hybridization on the surface of a charge coupled device

Abstract

A method is described for the detection of DNA hybrids formed on a solid support, based upon the pairing of oligonucleotide chemistry and the technologies of electronic microdevice design. Surface matrices have been created in which oligonucleotide probes are covalently linked to a thin SiO2 film. 32P labeled target nucleic acid is then hybridized to this probe matrix under conditions of high stringency. The salient feature of the method is that to achieve the highest possible collection efficiency, the hybridization matrix is placed directly on the surface of a charge coupled device (CCD), which is used to detect 32P decay from hybridized target molecules (1, Eggers, M.D., Hogan, M.E., Reich, R.K., Lamture, J.B., Beattie, K.L., Hollis, M.A., Ehrilich, D.J., Kosicki, B.B., Shumaker, J.M., Varma, R.S., Burke, B.E., Murphy, A., and Rathman, D.D., (1993), Advances in DNA Sequencing Technology, Proc. SPIE, 1891, 13-26). Two implementations of the technology have been employed. The first involves direct attachment of the matrix to the surface of a CCD. The second involves attachment of the matrix to a disposible SiO2 coated chip, which is then placed face to face upon the CCD surface. As can be predicted from this favorable collection geometry and the known characteristics of a CCD, it is found that as measured by the time required to obtain equivalent signal to noise ratios, 32P detection speed by the direct CCD approach is at least 10 fold greater than can be obtained with a commercial gas phase array detector, and at least 100 fold greater than when X-ray film is used for 32P detection. Thus, it is shown that excellent quality hybridization signals can be obtained from a standard hybridization reaction, after only 1 second of CCD data acquisition.

Optimization of Gold Nanoparticle-Based DNA Detection for Microarrays

“…• C for 1 hr (for fluorescence labeling) or 2 min in 1% APTES/95% acetone/dH 2 O at room temperature (for nanoparticle labeling) according to modified protocols from the literature [14,15], respectively. After rinsing the GOPS-silanized probes in toluene, ethanol, and deionized water, the substrates were dried under a nitrogen flow and ready for further processing.…”

“…The 5 -aminomodified oligonucleotides (JenaBioscience, Jena, Germany) with a complementary sequence (NH 2 -C 6 -TTTTTTCAGCATGTGCTCCTTGA TTCTATG), a sequence containing one (NH 2 -C 6 -TTT TTTCAGCATGGGCTCCTTGATTCTATG) or three mismatches (NH 2 -C 6 -TTTTTTCAGCATTATCTCCTT GATTCTATG): and a totally noncomplementary sequence (NH 2 -C 6 -ACTGACTGACTGACTGACTGAC TGGGCGGCGACCT or NH 2 -C 6 -TAAGGTTCATGAG CCTTTCGAGGAGATGAAGTGTATTGGG) were diluted in 0.1 M KOH pH 8.5 for GOPS surfaces [14] and in 0.1 M NaHCO 3 pH 8.5 for APTES-functionalized substrates [15]. Different concentrations of the oligonucleotide solutions (0.5-100 µM) were manually spotted on the silanized surfaces (1 µL per spot) and incubated overnight at 37…”

Automation for Genomics, Part Two: Sequencers, Microarrays, and Future Trends

“…The microarray platform is in a 96-well customizable format for medium-density and high-throughput and up to 250 genes/array (Lamture et al 1994). In September 1999, Genometrix and Motorola, Inc. agreed to a coexclusive rights agreement to use and commercialize proprietary Genometix electronic DNA chip technology.…”

Parallel molecular genetic analysis

“…Detection labels have been based on fluorescence or chemiluminescence, and both primary (label on the target) and secondary (label on a molecule which binds a group on the target or duplex) detection are in use. 74 Detection devices include the proximal CCD, 64,75 CCD-microscope, 30,44 and PMT-confocal microscope [21][22][23][24][25][26] systems.…”