Diminished degradation of yeast cytochrome c by interactions with its physiological partners.

Abstract

The level and structure of yeast iso-icytochrome c and iso-2-cytochrome c, encoded by the nuclear genes CYCI and CYC7, respectively, are normally not altered in p-mutants, which completely lack the cytochromes aa3 subunits and cytochrome b that are encoded by mitochondrial DNA. In contrast, iso-cytochromes c containing the amino acid change Thr-78 -> Ile (T781) were observed at the normal or near-normal wild-type level in p+ strains but were completely absent in p-mutants. We have demonstrated with the "global" suppressor mutation Asn-52 -* Ile and by pulsechase labeling that the T781 iso-l-cytochrome c undergoes rapid cellular degradation in p-mutants. Furthermore, specific mutations revealed that the deficiency of T781 iso-i cytochrome c can be caused by the lack of cytochrome a-a3 or cytochrome cl, but not by the lack of cytochrome b. Thus, this and certain other, but not all, labile forms of cytochrome c are protected from degradation by the interaction with its physiological partners.Iso-l-cytochrome c (iso-1) and iso-2-cytochrome c (iso-2) are encoded by the CYCl and CYC7 nuclear genes, respectively (1, 2) and these isocytochromes c are found at 95% and 5%, respectively, of the total cytochrome c complement in derepressed cells of the yeast Saccharomyces cerevisiae (3). Early studies revealed that the levels and structures of both isocytochromes c generally are equivalent in p+ and related pstrains-i.e., mutants that completely or partially lack mitochondrial DNA and do not carry out mitochondrial protein synthesis. This finding is consistent with CYCl and CYC7 being nuclear genes and suggested that the synthesis of the isocytochromes c is not significantly influenced by other mitochondrial deficiencies. In contrast, p-strains are completely deficient in cytochromes b and a-a3, a result explained by the fact that mitochondrial DNA encodes cytochrome b and three of the subunits of cytochrome a-a3 (4).The identification and characterization of the iso-2 structural gene, CYC7, in the yeast S. cerevisiae were initially carried out with the CYC7-H1 and CYC7-H3 mutations that caused overproduction of iso-2 because of abnormal promoters (2, 5, 6). The initial screens carried out in these studies relied on complete or partial loss of iso-2 in CYC7-H1 p-and CYC7-H3 p-strains, presumably due to alterations in the translated CYC7 region. Although equivalent amounts of iso-2 were observed in p+ and p-strains having the normal iso-2 sequence, surprisingly about one-third of the cyc7-H1 mutants had a greater deficiency in p-compared with p+ strains (7). In fact, iso-2 was completely deficient in some cyc7-HJ p-mutants, while iso-2 remained at the normal level in the corresponding cyc7-HJ p+ strain.In this study, we have demonstrated that certain amino acid replacements caused iso-1 and iso-2 to become susceptible to degradation preferentially in p-mutants. Furthermore, this increased sensitivity to degradation can arise by the absence ofThe publication costs of this article were defrayed in part by page charge p...

Identification of the contiguous Paracoccus denitrificans ccmF and ccmH genes: disruption of ccmF, encoding a putative transporter, results in formation of an unstable apocytochrome c and deficiency in siderophore production

“…Pulse-chase procedure. Pulse-chase measurement of cellular degradation of apo-and holocytochrome c550 used a method similar to that of Pearce & Sherman (1995). Cells were grown aerobically to mid-exponential phase in P. denitrificans minimal media containing 0.6 ' / o (w/v) Bacto-peptone (Difco) and 0.2% (w/v) yeast extract (Difco), harvested by centrifugation at 10000 g for 5 min and twice washed by suspension in sterile distilled water and recentrifugation.…”

“…[35S]methionine [1300 Ci mmol-' (48 MBq mmol-l) ; Amersham] was added to a final concentration of 125 pCi ml-l and the culture was incubated for 5 min at 37 "C. Samples were then processed essentially as described by Pearce & Sherman (1995) except that anti-cytochrome c550 (P. denitrificans) serum, which recognizes both apo and holo forms of the cytochrome, was used. Analytical methods.…”

BTN1, a Yeast Gene Corresponding to the Human Gene Responsible for Batten's Disease, is Not Essential for Viability, Mitochondrial Function, or Degradation of Mitochondrial ATP Synthase

“…B-10219 was prepared by deleting BTN1 by the one-step procedure, first by obtaining the gene with the polymerase chain reaction (PCR), essentially as previously described (Pearce and Sherman, 1995a). The forward and reverse primers used for the PCR were CGCGTACTACAAGAAAAAGTGAACC CTTA and AGCATCTAACACTTTATTTCAA TCTCCT, corresponding to the first nucleotide at positions 118 and 1519 of YJL059w, respectively.…”

The role of protein degradation in mitochondrial function and biogenesis

“…Certain variants are rapidly degraded when cytochromes aa 3 or c 1 , its physiological partners, are absent (Pearce and Sherman 1995b). Conversely, cytochrome aa 3 is absent in cyc1/cyc7 double mutants, lacking both isoforms of cytochrome c (Pearce and Sherman 1995a).…”

“…Yet another protease seems to be responsible for the degradation of the intermembrane space (IMS)-proteins, as neither of the above mentioned ATP-dependent proteases is responsible for degradation of cytochrome c (Pearce and Sherman 1995b). Putative candidates are cytochrome c hydrolyzing proteases associated with sub-mitochondrial particles (Novikova et al 1981;Zubatov et al 1984), an ATP-dependent proteolytic activity in the inter-membrane space (Sitte et al 1995) and, in mammalian cells, an ATPdependent protease activity that requires ATP outside the inner membrane (Rapoport et al 1982).…”