Dimethyl Sulfoxide Enhances Kaposi’s Sarcoma-Associated Herpesvirus Production During Lytic Replication

Abstract

Kaposi’s sarcoma-associated herpesvirus (KSHV) is an etiologic agent of Kaposi’s sarcoma, primary effusion lymphoma, and multicentric Castleman disease. In studies of KSHV, efficient virus production and isolation are essential. Reactivation of KSHV can be initiated by treating latently infected cells with chemicals, such as 12-O-tetradecanoyl-phorbol-13-acetate and sodium butyrate. These chemicals have been used as tools to induce lytic replication and viral production in KSHV-producing cell lines. Dimethyl sulfoxide (DMSO) is an organosulfur compound that is frequently used as an aprotic solvent similar to water. In experiments exploring signaling pathways in KSHV-infected cells, DMSO treatment alone as a vehicle affected the lytic gene expression of KSHV. However, to the best of our knowledge, the effects of DMSO on KSHV-producing cells have not yet been reported. Therefore, in this study, we investigated whether DMSO could be used as a reagent to enhance viral production during lytic replication in KSHV-producing cells and assessed the underlying mechanisms. The effects of DMSO on KSHV production were analyzed in iSLK BAC16 cells, which have been widely used for recombinant KSHV production. We found that the production of KSHV virions was significantly increased by treatment with DMSO during the induction of lytic replication. Mechanistically, lytic genes of KSHV were enhanced by DMSO treatment, which was correlated with virion production. Additionally, DMSO induced the phosphorylation of JNK during lytic replication, and inhibition of JNK abolished the effects of DMSO on lytic replication and virion production. Our findings showed that additional treatment with DMSO during the induction of lytic replication significantly improved the yield of KSHV production.

CXCL1 confers a survival advantage in Kaposi's sarcoma‐associated herpesvirus‐infected human endothelial cells through STAT3 phosphorylation

“…The next day, the medium was changed to Opti‐MEM™, including the chemicals inhibitor or vehicle, and 24 h later, cell viability was measured using WST‐1 reagents (Sigma‐Aldrich) according to the manufacturer's instructions. Cell death was analyzed using an Lactate dehydrogenase (LDH) Cytotoxicity Detection kit (Merck) as described previously with minor modifications 24 . To exclude the effect of cell proliferation, the results were normalized based on the optical density of the cell lysates.…”

“…Total RNA extraction and cDNA synthesis were conducted using a Ribospin II Kit (GeneAll Biotechnology) and PrimeScript™ RT Master MIX (Takara), respectively, according to the manufacturer's instructions. Takara SYBR™ FAST qPCR mix was used for qPCR, which was performed as described previously 24 . The following primers were used: CXCL1F, 5′‐ATAGCCACACTCAAGAAT‐3′ and CXCL1R, 5′‐TTGGATTTGTCACTGTTC‐3′, for CXCL1; ORF50F, 5′‐TGCTGGAGGATGTGTGCATT‐3′ and ORF50R, 5′‐CTCCGTGAGGATCCGAATAA‐3′, for KSHV ORF50; ORF59F, 5′‐ TTAGCCTGGGAGTCCTTAATC‐3′ and ORF59R, 5′‐ GCACACCTTCCACTTCTA‐3′, for KSHV ORF59; ORF26F, 5′‐GGAGATTGCCACCGTTTA‐3′ and ORF26R, 5′‐ACTGCATAATTTGGATGTAGT‐3′, for KSHV ORF26; ORF65F, 5′‐ACTATCTCGTGTTCTTAATTGC‐3′ and ORF65R, 5′‐ATGATCCCGCCTTTGAAT‐3', for KSHV ORF65; K8.1F, 5′‐TAAACCCACAGCCCATAG‐3′ and K8.1R, 5′‐CCACCACTACAACGACTA‐3′, for KSHV K8.1; ORF73F, 5′‐AGACACAGGATGGGATGGAGC‐3′ and ORF73R, 5′‐AGACACAGGATGGGATGGAG‐3′, for KSHV ORF73; GAPDHF, 5′‐GGTATCGTGGAAGGACTC‐3′ and GAPDHR, 5′‐GTAGAGGCAGGGATGATG‐3′, for GAPDH.…”

“…Western blot analysis was performed as described previously. 24 Immunodetection was performed using primary antibodies against HHV8 K8.1, total ERK, total STAT3 (all from Santa Cruz Biotechnology), HHV8 ORF45 (Thermo Fisher Scientific), β-actin (Sigma-Aldrich), total AKT, HHV8 ORF50, total p38 MAPK, phosphorylated p38 (p-38) MAPDK (Thr180/Tyr182) (all from Bioss Inc.), p-AKT, phosphorylated ERK, p-STAT3 (all from Cell Signaling Technology), GAPDH (Cusabio Technology) originating from rabbit, and against HHV8 LNA (Abcam) originating from rat. The secondary antibodies conjugated with horseradish peroxidase were goat anti-mouse IgG, goat anti-rabbit IgG, and goat anti-rat IgG (all from Bethyl Laboratories).…”

“…Cell death was analyzed using an Lactate dehydrogenase (LDH) Cytotoxicity Detection kit (Merck) as described previously with minor modifications. 24 To exclude the effect of cell proliferation, the results were normalized based on the optical density of the cell lysates.…”

HMGB1, a potential regulator of tumor microenvironment in KSHV-infected endothelial cells

“…iSLK BAC16 cells were treated with 1.2 mM sodium butyrate (Sigma, Burlington, MA, United States) and 50 μg/mL doxycycline (Sigma) for 48 h to induce lytic replication. Upon the induction of lytic replication, DMSO was added to the culture media together with sodium butyrate and doxycycline at 0.1, 0.5%, or 1% of the total volume ( Kang et al, 2021b ). For virus isolation, the culture medium was collected and centrifuged at 300 × g for 10 min at 4°C to remove cell debris from the culture supernatant.…”